You are on page 1of 126

Bilim v e G elecek Kitapl - 1 9 5 0 Soruda Kitap Dizisi - 7 5 0 Soruda Y aam n Tarihi Deniz ahin Bu kitabn yayn haklan 7 Renk

k Basm Yaym ve Filmcilik Ltd. ti.'ne aittir. Birinci Bask: Bilim ve G elecek Kitapl, Mart 2011 kinci Bask: Bilim ve G elecek Kitapl, Ekim 2011 ISBN: 9 7 8 -6 0 5 -5 8 8 8 -1 7 -6 Dizi Editr: Naln M ahsereci Kapak Tasarm : Deniz Akkol ayia Tasarm : Eren Taymaz Bask: Kayhan Matbaaclk Davutpaa Cad. Gven Sanayi Sitesi B Blok No: 2 4 4 Topkap - stanbul Tel: 0 2 1 2 .6 1 2 31 85 7 Renk B asm Yayn ve Filmcilik Ltd. ti Moda C. Zuhal Sk. No: 9/1, Kadky-stanbul Tel: 0 2 1 6 .3 4 9 71 72 http://www.bilimvegelecek.com.tr e-mail: bilgi@bilim vegelecek.com .tr

yaamn tarihi
DENZ AHN

NDEKLER Sunu / Naln Mahsereci nsz 11 13 13 9

1. Blm BLMSEL YNTEM 2. Blm YAAM NEDR?

1) Bilimsel yntem nedir? Nasl bir yol izler? 17

2) Canl nedir? 17 3) Yaamn organizasyonu nasldr? Snrlar nelerdir? 20 4) Arsenik seven bakteriler: Yaamn biyokimyasnn tanm deiiyor mu? 23 5) Hcrenin temel yaptalar nelerdir? Hcrede bilgi ak nasl olur? 25 3. Blm CANLILARIN SINIFLANDIRILMASI 33 6) Canllar nasl snflandrlr? 33 7) Dnya zerinde isimlendirilebilen canl tr says katr? 39 4. Blm EVRM 41 8) Canllar nasl eitlenmitir? Evrim nedir? 41 9) Evrim fikri nasl ortaya kmtr ve gelimitir? 10) Evrimin alma mekanizmas nedir? 49 11) Evrim kuramyla ilgili yanl bilinen noktalar nelerdir? 53 12) Evrimin kantlar nelerdir? 60

42

5. Blm SU ve DNYA DII YAAM

67

13) Suyun yaam iin nemi nedir? 67 14) Evrende yaam nerelerde ortaya kabilir? Yaanabilir blge nedir? 70 15) Dnya dnda yaam var mdr? 73
6. Blm YAAMIN KRONOLOJK GELM 6.1. BYK PATLAMA 81 81

38) Ozon tabakas nasl ortaya kmtr ve canlln gelimesi asndan nemi nedir? 39) Kambriyen Patlamas adlandrmas ne anlatr? 40) Bitkilerin evrimi ve karalara yaylm nasl gerekleti? 172 41) Drt-ayakllarn (tetrapodlar) evrimi nasl gerekleti? 177 6.4. DNOZORLAR DEVR 180

164 168

16) Evren nasl ortaya kmtr? 81 17) Evrenin yap maddesi nedir? 88 18) CERN deneyleriyle yaplmak istenen nedir? Byk Patlama tekrar gerekleecek mi? 90
6.2. GNE SSTEM ve DNYA 93

42) Dinozor nedir? Temel zellikleri nelerdir? 43) Dinozorlarn yaad dnemin zellikleri nelerdir? 186 44) Dinozorlar nasl yok oldular? (oldular m?) 6.5. MEMELLERN GELM 191 191

180

188

45) Memeliler nasl ortaya ktlar? 6.6. NSANIN EVRM 196

19) Gne Sistemi nasl olutu? 93 20) Dnya ne zaman ve nasl olutu? 96 21) Dnyann i yaps nasldr? 98 22) Ay nasl olutu? 101 23) Suyun kayna nedir? 104 24) Okyanuslar nasl olutu? 106 25) Atmosfer nasl olutu? 108 26) Dnya zerindeki ktalar nasl olumutur ve zaman iinde nasl deimitir? 111 27) Dnyann geirdii jeolojik devirler nelerdir? 117
6.3. YAAMIN ORTAYA IKII 123

46) nsan nasl evrimleti? 196 47) insann evrimindeki temel aamalar nelerdir? Dnyaya nasl yayldlar? 202 48) nsann 6 milyon yllk evriminin kantlar nelerdir? 209 7. Blm KTLESEL YOK OLU 215

49) Kitlesel yok olu nedir? Dnya zerinde canllk hi yok oluun eiine geldi mi? 215 50) Bugn 6. byk kitlesel yok oluun eiinde miyiz? Tehlike altndaki trlerin durumu nedir? 220 Sonsz 225 226

28) Dnyada yaam ne zaman balamtr? 123 29) Yaam nerede balad? 124 30) Yaam iin gerekli nc molekller nelerdir? ilksel orba kuram ne sylemektedir? 125 31) Miller deneyi ne an latyor? 131 32) Kendini oaltabilen ilk molekl/sistem hangisidir? 134 33) ilk hcre zar nasl olutu? 138 34) Eeyli reme nasl ortaya kt? Avantajlar nelerdir? 144 35) okhcrelilik nasl ortaya kmtr? 149 36) karyotlar nasl ortaya kmtr? 154 37) Fotosentezin evrimi dnyadaki yaam nasl etkilemitir? 160

Yaam Zaman Tablosu Kaynaklar 227

SUNU

Sunu _ 3
Bir kitabn en n itelikli okum as, sanrm ya bizzat k ita b n yazarysanz m m kn ya da greviniz ya da ereiniz gerei kitapla sk fk bir iliki iine g iriyorsan z... Bu n e denle kendim i 5 0 Soruda dizisi kitaplarnn en ansl oku ru sayyorum . Kitaplar yayma hazrlarken, m etnin eitli alardan ilenm esini de ieren grevim , m etnin sunduu bilgi erevesi, kurgusu, dil zellikleri, anlatm vs. zeri ne alm a gereklilii, ok ynl ve etkin bir okuma yap mam zorunlu klyor. Bu sre de doal olarak yllardr dzenli dzensiz edindiim bilim sel bilgilerin temel ve sistem kazanm asn salyor. Bunda, 50 Soruda dizisinin nitelii de etken tabii. 5 0 Soruda kitaplar, ele ald k o nudaki bilim sel birikim i sistem atik bir biim de yanstt gibi, ulalan son aam alar da ierm eyi hedefliyor. Bu da dizi kitaplarnn genelini okuyan okur iin , salam b ir b i lim kltr altyaps d em e k ... O kum akta olduunuz kitap, yayna hazrlk srecinde unu dndrtt bana: O rtaretim de b ir evrim der si olsa, Deniz ahinin yazd 5 0 S oru d a Y aam n T arihi kitab , bu ders iin bulunm az b ir kaynak o lu rd u ... in d ekiler sayfalarnda yer alan 5 0 soru balna gz atar sanz, sanrm bana hak vereceksiniz. Yazar kitab, ya am/canllk ve yaam n evrimiyle ilgili en temel bilgileri verecek ve bu konularda bilim sel bir bilin olum asna yardm edecek ekilde kurgulam ; ama bununla yetin m em i, ele ald konularla ilgili o k geni bir erevede akla taklabilecek tm n oktalar ve popler ilgi alanlar-

10

50 SORUDA YAAMIN TARH

NSZ

11

m da kitabn balam na katarak, b iro k okuru yakalaya b ilecek zenginlik, gncellik ve ilgi ek icilik te bir ierik yaratm : rnein CERN deneyleriyle yaplm ak istenen n ed ir?, D inozorlar D evri balklar yazarn bu abasn gsteriyor. Yazar, bilim sel okum alar ncesinde oluabilecek an lalm azlk nyargsn krm ak iin de elinden geleni ya pyor. Yantlar yaln bir kurguyla, ekillerden de yararla narak ve tank olduumuza gre, eitli okurlar zerinde test ettii bir anlalrlkla veriyor. Deniz ahin, 5 0 Soruda dizisinin im dilik en gen ya zar. Kitabn n kulandaki zgem iinden okuyacanz gibi, gen akademisyen kuann, evrim kartl zelin de gelien bilim dlkla m cadele etm eyi kendine grev edinm i yelerinden. Tabii ki, yaam n tarihinden sz etm ek, asl olarak evrimden sz etm eyi gerektirir. Ama yazarn Evrim kuram yla ilgili yanl bilinen noktalar ne lerd ir? biim inde bir soru form le etm esinde, az nce sz ettiim iz niteliinin belirleyici olduunu sanyorum . Keyifle okum alar... *** Elinizde zgn ve nitelikli bir rneini tutm akta o l duunuz 50 Soruda dizisi, bilim in ve felsefenin temel kuram larn ve alanlarm konu edinen, Trkiyeli bilim insanlarnn kalem e ald popler bilim kitaplarndan oluuyor. Bu kitaplar, bilim in, anlalmaz, karm ak, ha yattan kopuk, souk, kuru ve teknolojiye indirgenm i bir bilgi yn olm adn; tam tersine, evreni, doay, toplu mu ve insan anlam ak iin doru anahtarlar sunan; bilm e, renm e cokusu uyandran; en gvenilir bilgi kayna olduunu ve salam bir dnme yntem i kazandrdn gsterebilm eyi hedefliyorlar. Bir aydnlanm a hizm eti olarak tasarladmz 50 So ruda dizisinin 23 kitaplk listesinin tamamna ve bu k i taplar edinebilm ekle ilgili zel kampanya duyurulanna, elinizdeki kitabn arka sayfalarndan ulaabilirsiniz. Herkese bilim !

nsz
Mustafa Kemal Atatrkn yeni nesillere brakt en nem li miraslardan birisi, dnyaya bak am z ekil lendirecek bir dnce biim idir. Daima ileriye ve daha gzele gitm e istei bu dnce eklinin tem elinde yatar. Bu istei gerekletirebilm e yeterliliinin zerine kuru l duu tem el ise, bilim ve bilim sel dncedir. Bize den, bilim sel dnceyi yaam m zn tem eline oturtm ak ve sa dece belirli yerlerde deil, tm davran ve kararlarm zda bilim sellii tem el alm aktr. Bu yolda yapacamz ilk ve en basit i daha fazla bilm ek iin daha fazla okum aktr. Uur M um cunun bilgi sahibi olm adan, fikir sahibi olunm az sz bu duruma ok uy gun bir sz. Bu yzden 5 0 Soru d a... kitap dizisi projesi ok nem li b ir grevi stleniyor. Hayatm z ekillendiren en tem el konularda, bilinm esi gereken noktalar her oku yucunun anlayabilecei gncel bir dille anlatlyor. Bu dizinin bir paras olan 5 0 Soruda Yaam n T arihi kitabnda, byk patlamadan gnmze kadar geen m il yarlarca yl ierisinde, evren, Gne Sistemi ve Dnyamn ekillenm esini, basit molekllerden en karmak yapdaki organizmalarn nasl olutuunu, milyarlarca yllk evrim sonucunda yaamn dnya zerinde nasl eitlendiini, hangi aamalardan geerek gnmze geldiini ele aldk. nsanolunun, milyarlarca yllk yaam tarihinin son nokta snda ortaya km a ve dnyann dzeni zerindeki olum suz etkilerine deindik. Yaamn milyarlarca yldr sren grkem li hikyesi iinde ortaya kan milyonlarca farkl t rn dnya zerini sardn, insanolunun ise bu trlerden

Naln Mahsereci

BLMSEL YNTEM

13

12

50 SORUDA YAAMIN TARH

sadece bir tanesi olduunu aka vurguladk. Verdiimiz her bilgi, kaynaklara ve bilim sel deney sonularna dayan maktadr. Bu sonular kolay elde edilmemitir. Yzlerce yl boyunca saysz bilim insan, bilim in gelimesi iin hayat larn feda etti. Yaplan binlerce deney, elde edilen saysz kant sonucu, bilim gnmzdeki seviyeye ulat. Bu noktada bizlere den, bu bilgiyi alm ak, zm se m ek ve yaam m zn tem eline oturtm aktr. Daha ada ve ileri bir yaam iin, daha ok bilm ek iin, daha ok okum al, bilim sel ilerlem eden yana olm al. ic * Son olarak kitabn yazm srecinde bana destek olanla ra teekkr etm ek istiyorum. Umarm gzden kardm kim se olmamtr. ncelikle, Bilim ve Gelecek yneticisi Ender Helvacolu ve editrmz Nlan M ahsereciye bu kitap dizisini kltr yaammza kazandrdklar ve bana gsterdikleri destek ve sabrdan dolay teekkr ediyorum. Aileme de desteklerini eksik etm edikleri iin teekkr ederim. zellikle ablam Nevin ahin, beni srekli motive etm itir. Tabii bir de ailem izin nee kayna, yeni yesi var. Yeenim Doa ahin, henz 19 aylk. Ona teekk rm b ir fotorafm kitap iinde kullanarak verm ek iste dim. Cem Evren, zay zcan bata olm ak zere Manisa ve Havzadaki kuzenlerim e, kitabn dili zerine yaptklar nerilerden dolay teekkr ederim. Um uyorum keyifle okuyacaklar bir kitap olm utur. IT M olekler Biyoloji ve G enetik Blm nden teek kr etm ek istediim ok arkadam var. Pnar Hner, C e ren A lkm , Haan Kahram an, Abdullah Sert, Sakip nder, Urartu zgr afak eker, V olkan Demir, Koray Yeiladal, Esra Yuca ve Anl C ebeci bata olm ak zere adla rn buraya yazamadm tm arkadalarma, kaynaklara erim em deki yardm lar ve kitabn akcl ve dili zerine nerileri iin teekkr bor bilirim . Kapak grseli uygu lam asna katklarndan dolay arkadam Cum hur Omaya ayrca teekkr ederim.

1. Blm BLMSEL YNTEM NEDR?

I Bilimsel yntem nedir? I Nasl bir yol izler?

Deniz ahin, ubat 2010

Bu, sadece bir teoridir. Yukarda okuduunuz bu cm leyi belki h er gn duyu yor olabilirsiniz. G nlk konum alarnzda, televizyon lardaki tartm alarda ya da internette gezinirken karnza m utlaka km tr. G enel olarak bu ifade, kesin olmayan, kt zerinde m m kn ancak pratikte m m kn olm a yan durum lar iin kullanlr ve kanlm az olarak da siz teori kelim esini her duyduunuzda, aklnzda, yetersiz lik ieren b ir durum oluacaktr. Bu durum ou yer de sizi yanla srkleyecek bir sonu oluturm ayabilir, ancak sz konusu durum bilim sel bir konu olduunda, durum hakknda yanl fikirlere kaplabilir, bilim sel ola rak sunulan bir gerek karsnda pheye debilirsiniz. Terim leri yanl yorum ladnzda da, verilen bilgiyi kav ram anz zorlaacaktr. O kuduunuz bu kitap yaam zerine sorulm u sorula ra verilen bilim sel cevaplar ieriyor. Bu cevaplar, saysz bilim insannn trl zorluklara kar yrttkleri al m alarnn sonulardr. Yzlerce yl boyunca snanm ,

14

50 SORUDA YAAMIN TARH

BLMSEL YNTEM

15

birikerek gnmze ulam ve aklm z megul eden te m el sorulara cevap olarak karm za km lardr. Bilim in kendine zg bir dili ve alm a ekli vardr ve cevaplarn daha iyi kavranm as iin bilim sel yntem den bahsetm ek yararl olacaktr. Aada teori kelim esinin bilim sel k u l lanm ndaki anlam n da greceksiniz. Bylece, terim lere gnlk kullanm da nasl farkl anlam lar yklenebildiini de grm olacaksnz.

Bilimsel yntemin izledii yol


Bilim insannn en tem el zelliklerinin banda m erak l olm as geliyor diyebiliriz. evresinde olup biten doal sreleri, byk bir m erakla takip eder. O nlar gzlem ler, notlar alr, farkl gzlem leri birbiriyle karlatrr. K saca s, bilgi toplar. Yaplan her gzlem ile birlikte, kanlm az olarak, cevaplanacak sorular da beraberinde gelir. Bilim insan da karlat bu sorunun zm iin bilim sel yntem adn verdiimiz tem el adm lar takip eder. O h al de bilim sel bir sorunun zlm esine giden yoldaki ilk ba sam ak olarak gzlem yapmay sayabiliriz. (ekil 1) G zlem le birlikte gelen sorunun zlm esi iin de elde edilen tm bilgi kullanlarak, sorunun zm ne yne lik bir fikir ileri srlr. te bu fikir de hip otez olarak adlandrlr. Eldeki verilere uygun olmaldr. Doru ya da
ekil 1. Bi limsel yntemin temel adm lar.

yanl olabilir; ancak nem li olan nokta, hipotezin yapla cak deneylerle snanabilir olm asdr. Bir sorunun zm iin b iro k farkl hipotez ortaya srlebilir. Bir sonraki adm ise ne srlen hipotezden karm lar yaplm as ve her karm n da bilim sel deneylerle test edilm esidir. Yaptnz her deneyle, ne srdnz h i potezi snam olursunuz. Deney grubu ile karlatrm a yapabileceiniz bir kon trol grubu kullanm anz, deney sonularnn salkl ekilde elde edilm esini salayacak tr. Bilim insanlar bilim sel m akalelerinde yaptklar de neylerin detaylarn da yazarlar. Farkl kiiler ayn deney artlarn uyguladklarnda ayn sonular elde etm elidir. Bu, deneyinizin doruluunu gsterir. Deney sonular hipoteziniz ile uyumlu olm ak zorunda deildir. Tutarsz sonular karsnda, tekrar hipotez aa m asna dnlerek hipotez gzden geirilir ve gerekli d zeltm e yaplr. Sonulara gre hipotez tamamyla da terk edilebilir. Tutarl sonular elde edildiinde ise deneylere devam edilir. F arkl bilim insanlar tarafndan uygulanan farkl yntem ler ile hipotez snanm aya devam eder. Elde edilen h er tutarl sonu ile hipotez teori olm a yolunda ilerler. T eori ise, yaplan kontroll bilim sel deneylerle s rekli olarak dorulanmaya devam eder. Teori, kendisini yanllayan bir sonu elde edilmedii srece, glenm eye devam edecektir. Sadece bir ksm bilim insannn deil, tm bilim cilerin kabul edecei som ut deney sonularna gerek duyar. rnek verm ek gerekirse, hcre teorisi can llarn hcrelerden olutuunu, atom teorisi maddelerin atom lardan olutuunu anlatr. Benzer ekilde evrim te orisi de canllarn ortak bir atadan gelerek nasl eitlen diini anlatr.

rnek hipotez
Yntem in daha iyi anlalabilm esi iin basit bir rnek zerinden devam edelim. Diyelim ki, mutfaa geldik ve buzdolabn atm zda ok kt kokular almaya baladk. Bu yapm olduumuz gzlem sonucunda elde ettiim iz

16

50 SORUDA YAAMIN TARH

YAAM NEDR?

17

bir veri. K okunun nereden kaynaklandn dnmeye baladmzda aklm za st geliyor. Hem gzlemlerim iz hem de daha nceki deneyim lerim iz, bize stn bozularak dolab kokutm u olabileceini dndrtyor. O halde hipotezim iz, D olaptaki st bozulm u ise dolaptaki kt kokuya neden olm utur eklinde kurulabilir. imdi ise yapmamz gereken hipotezim izi snam ak. Yapacamz en basit deney, stn kapan aarak koklam ak. Eer dolap tan aldmz kokunu n aynsn alm yorsak, hipotezim izi terk edebiliriz. Bu durumda farkl bir hipotez kurm am z gerekecektir. A ncak st kutusundan da benzer kokular alyorsak, hipotezim izi snamaya devam etm eliyiz. rne in, dier yiyecekleri k on trol ederek kokunun onlardan da gelip gelm ediini anlamaya alabiliriz. Yaptmz her test hipotezim izi snayacaktr. H ipotezim iz testleri getii srece de glenecektir. Bilim sel teoriler de hipotezlerin saysz testten gem esi sonucu ortaya karlar. Burada tem el olarak giri yapt mz bilim sel yntem in ve ilgili terim lerin doru ekilde kavranm as, kitap boyunca karm za kacak konular daha rahat kavram am z salayacaktr.

2. Blm YASAM NEDR?

Canl 21 I nedir?
O rtalam a mr 6 0 -8 0 yl aras olan biz insanlar iin m ilyarlarca yllk bir zaman dilim ini kavram ak kolay bir i deil. K stl bir zamanda, k stl b ir evrede yayoruz ve bu yzden olsa gerek, edindiim iz bilgi ve deneyim, yaam n dnya zerindeki yolculuunu tam olarak kav ram am z zorlatryor, ilk canllar, insanlar dnya ze rinde ortaya km adan m ilyarlarca yl nce ortaya ktlar. Aradan geen zaman ile m ilyonlarca farkl tre evrilerek dnya zerinde yaylm adk o k az b ir yer braktlar. Canl eitlilii yle byk boyutlara ulat k i, ok farkl vcut yaplarna sahip trleri ok kk b ir alanda gzlem le m ek m m kn oldu. Btn bu farkllamaya kar, baz zellikler tm canllarda ortak olarak grlm eye devam etti. Peki, tm canllarda ortak olarak gzlenen bu zel likler nelerdir? Canl ile cansz birbirinden ayran nedir? Ksacas canl neye denir? (ekil 2) C anlnn ne olduu sorusu bilim dnyasnn uzun za mandr cevabn arad sorulardan birisidir. Ortaya ko-

18

50 SORUDA YAAMIN TARH

YAAM NEDR?

19

4 ) M etabolizm aya sahiptir. Baka bir deyile, hcre iinde yapm ve ykm ilerini srdrr. H cre ii k sm larn yapm iin (anabolizm a) en erji ve kim yasallar k u l lanr ve gerektiinde hcre iin d eki organik materyalin ykm m gerekletirir (katabolizm a). Bu kim yasal tepki m eleri dzenli bir ekilde gerekletirebilm ek iin enerji kullanr. 5) Canllar byrler ve oalrlar. Organizmay oluturan her para zaman ierisinde boyut olarak byr. Belirli bir zamandan sonra saysal olarak da artarlar. Bunu aseksel olarak yani blnerek ya da seksel olarak yani baka bir organizm a ile genetik m ateryalini birletirerek gerekletirebilirler. 6 ) Canllar DNA ve/veya RNA olarak bilinen nkleik asitleri tar. Bu m olekllerde depolanan bilgiler yeni n e sillerin meydana getirilebilm esi iin kullanlr ve nesilden nesile aktarlr. 7) G enetik yapsnda deiiklik geirir (m utasyon) ve bunun sonucunda da zaman ierisinde doal seilim e urar. Bununla birlikte bu zelliklerin her birini ayr ayr ger ekletiren cansz sistem ler de bulabiliriz. Bu yzden de canly tanm larken bu zelliklerin ounu bir btn ola rak alm ak daha m antkl olacaktr. Yaam btnleik bir sistem (biyosfer) oluturur. Bu sistem in hafzas vardr, ynlenerek hareket eder, reyerek oalr, m etabolizm a ya sahiptir ve en erji akn dzenler. F izik asndan ya amn tanm n yapmaya alrsak yle diyebiliriz: Ya am, sistem ile evresi arasndaki bir etkileim ya da bir oyun srecinin sonucudur. Oyun sresince sistem daha nceki turdaki kazan ve kayplar hatrlayacak bir kabili yet gelitirm eli ve bu ekilde de bir sonraki tura kalabilm e ans yakalamaldr.

ekil 2. Devasa hayvanlardan gzle grem ediim iz boyutlardaki


hcrelere, yaam m ilyonlarca farkl ekillerde karmza kmtr. Solda, soyu 6 5 milyon yl nce tkenen 13 metre uzunluundaki Tyrannosaurus rex (fosil rneklerine gre yaplan izim); sada altta 5 0 mikrometre uzunluunda tekhcreli protista Euglena gracilis (1 mikrom etre, metrenin milyonda biridir), sada stte 0 ,7 metre boyunda kz ocuu.

nulan hipotezler, yaam n tanm n yaparken farkl zel likleri n plana karm lardr. A ncak bilim dnyasnda kabul gren genel gre gre aada sayacam z temel zellikler canl ile cansz birbirinden ayrmaya yaraya caktr: 1) C anl bir ya da daha ok hcreden oluan b ir orga nizasyona sahiptir. Kurduu bu organizasyon sayesinde kendi devamn salayabilir. 2) H om eostaz ad verilen bir i dzeni vardr. Canl d dnyadan gelen etkiler karsnda i dengesini k oru yabildii srece yaam n srdrecektir. 3) Sahip olduu i dengeyi koruyabilm enin tem elinde, d evreden gelen uyanlara tepki verebilm e kabiliyeti bulunur. evreden gelen etkileri alglayp belirli tepkiler verirler. Bu tepkiler byk sklkla hareket eklinde olabi lir. iek yapraklarnn gnee doru ynelm eleri rnek verilebilir. V erilen tepkilerin sonucu olarak da evreye uyum gsterilir (adaptasyon). Bu da canlnn evrilm esinin tem elinde yatan gerekliliktir.

Virsler canl mdr?


ok sk olarak sorulan sorulardan biri de virslerin canl olup olm adklardr. Virsler, genetik malzemeye sahiptir, doal seilim yoluyla evrilir ve kendilerini o-

20

50 SORUDA YAAMIN TARH

YAAM NEDR?

21

ekil 3 . AIDS hastalna yol aan HIV virs.

altabilirler. A ncak kendi ilerinde m etabolizm aya sahip deildirler ve bunun iin de konak bir organizmaya ih tiya duyarlar. Tek balarna bakldnda bir canldan o k kim yasal b ir yap gibidirler. ksm da DNA ya da RNAdan oluan genetik m ateryal, d ksm da protein k lf ile evrilidirler. Bu anda bir canlnn zelliklerini gsterdikleri sylenem ez. Ancak hcre ierisine girdikle ri andan itibaren, hcrenin olanaklarn kullanarak aktif bir canl gibi alr ve kendi kopyalarn olutururlar. Bu yzden ou bilim insan virsleri, canllar ile canszlar arasndaki snr noktasnda eklinde tanm lar. (ekil 3)

da en byk yapta olan biyosferi daha kolay anlam a m z salayacaktr. Biyosfer, dnya zerinde canlln bulunduu blgelerin toplam na verilen isimdir. Tm canl ve cansz varlklar bu alanda birbirleriyle etkileim ierisinde bulunur. Toplam geniliinin tam olarak ne kadar olduunu sylem ek m m kn olmasa da yaklak bir deer verilebilir. rnein, benekli akbabalarn 1 1 .0 0 0 metreden daha yksekte uabildii bilinm ektedir. Bu se viyeden ok daha ykseklerde m ikroorganizm a rnekleri ne de rastlanm tr. D enizlerin diplerine gidecek olursak, yzeyden 11 km derinlerde foram inifera (delikliler) ad verilen tekhcreli organizm alar bulunm utur. Ulalm as g blgelerde yeni canllar kefedildike, biyosferin s nrlar da genilem ektedir. (ekil 4) Canllar biyosfer iinde sadece geni bir alana yayl m akla kalm adlar, ayn zamanda geni bir scaklk, pH (asit-baz), radyasyon vb. aralnda da yayldlar. rn e in, Arkea lem inden baz m ikroorganizm alar (P yrolobus fu m a r ii ), deniz altnda bulunan ve m agm ann topran al tndan k yapt yerler olan hidroterm al bacalarn ze rinde yaamaktadr. Bu organizm alarn 113 C scaklkta yaayabildii biliniyor. M arin om on as prim oryen sis ad ve rilen bakteriler de Antartikada bulunan gllerde -2 0 C scaklklara kadar yaayabilmektedir. Arkea leminden F errop lasm a acid arm an u s ad verilen m ikroorganizm a pHm 0 a yakn olduu asit m adenlerinde yaayabilir. Deekil 4. Solda benekli akbaba (Ruppel's griffon), sada ise foram inifera rnekleri.

organizasyonu nasldr? 3 I1Yaamn Snrlar nelerdir?


Biz insanlar, yllarm z dar bir evre ierisinde geir m ek zorunda kalyoruz. Yaam koullar ve zellikle e hirlem enin artyla doadan her gn biraz daha uzak layoruz. Bu yzden dnya zerindeki canl eitliliini, yaam n ulaabildii snrlar ve oluturduu organizas yonu daha iyi kavrayabilm ek iin daha geni b ir adan bakabilm eye ihtiyacm z var. D iyelim ki, Dnyam n evresinde yrngede dnm ek te olan bir uzay istasyonundayz ve pencereden D nyaya doru bakyoruz. G rdm z bu manzara, dnya ze rindeki yaamn organizasyonunda en yksek seviye ya

22

50 SORUDA YAAMIN TARH

YAAM NEDR?

23

in ococcu s radiodu ran s ad verilen bakteriler de, yksek radyasyon altnda (insann yaayabileceinin 3 0 0 0 kat) yaamaya devam ederler. Tm bu rnekler bize canlln snrlarnn bizim dndmzden o k daha u n okta lara gidebileceini gsteriyor. Devam edelim ve pencereden bakm ak yerine bu sefer de gelimi bir teleskopla Dnyaya baktm z dne lim . Daha yakm a gelelim. Biyosferden sonra karm za ilk kan yapta ya da organizasyon ekosistem olacaktr. Ekosistem , belirli bir blgede bulunan tm canl ve can sz evreden olum aktadr. Hava, toprak, su, kayalar ve tm canl trleri birbirleriyle etkileim halinde ekosistemin paralarn oluturacaktr. Kk bir su birikintisi de, Sahra l de birer ekosistem dir. Dnya yzeyi b ir birleriyle etkileim halinde olan ve srekli olarak deien ekosistem lerle kaplanm tr. rnein, ekil 5de grld gibi bir da gl bir eko sistem oluturmaktadr. G l ierisinde, canl ve cansz var lklar etkileim halinde bulunur. Ekosistem ler deiken olsalar da, belirli bir dengeye sahiptirler. Ekosistem i olu turan bileenler arasnda, enerji dngs ve besin zinciri kurulm utur. Ekosistem ierisinde bulunan farkl canl gruplarnn hepsine birden ise kom unite ad verilir. Eer daha detaya inecek olursak, bir sonraki seviyemiz poplasyon seviyesidir. Poplasyon ayn trden bireyle rin belirli bir blgede oluturduu topluluk olarak adland rlabilir. Poplasyon tek bir trden oluur, ancak ayn blekil 5. Bir da gl, barndrd
canl ve cansz varlklarla bir ekosistem

den farkl yaplanmalar geirir. Bir ksm organ ve dokular gibi ara seviyede organizasyon ierse de, tm canllarn ortak yapta hcredir. ster tekhcreli isterse okhcreli olsun, tm canllar hcrelerden olum utur. Hcre, yaa m n en kk birim i olarak gsterilebilir. 5. Soruda hcre yi oluturan temel m olekllerden de bahsedeceiz.

Arsenik seven bakteriler: Yaamn biyokimyasnn tanm deiiyor mu?


Srad ortamlarda yaayan canllara bir rnek de ar senikte yaayabilen bakteriler. 2 0 1 0 Aralk aynn ban da, NASAdan aratrm aclar, zel bir basn toplantsyla Kaliforniyada bulunan M ono G lnden izole edilen (tuz ve arsenik oran yksek bazik bir ortam ) ve GFA J-1 ( H alo m on ad a cea e tr-yksek tuz koullarnda yaayabilen trler) ad verilen bakterinin yapsnda fosfor (P) yerine arsenik (As) kullandn akladlar. (ekil 6) Bu, yaam n kim yasn yeniden tanm layacak bir ge lim e olabilir. imdiye kadarki bilgilerim ize gre 6 tem el elem ent tm can llarn yapsnda bulunur: Karbon (C ), hidrojen (H ), azot (N ), oksijen (O ), k krt (S) ve fosfor (P ). Bu elem entler hcrede bulunan nklek asit, protein mikroskopik grnts. ve ya gibi biyom olekllerin yapsna katlarak, yaamn tem elini oluturur. Ancak teorik olarak dier baz elem entler bu 6 ana elem entin ye rini alarak ayn grevleri yerine getirebilir. rnein, arse nik periyodik tabloda fosfor ile ayn gruba girer ve yapsal olarak fosfora benzer. Bu yzden de biyom olekller iin de kolayca fosforun yerini alabilir, ancak arsenikli yap almaz. Bu yzden de arsenik toksik zellik gsterir.
, , . ekil 6. GFAJ-1 bakterisinin

ge k in d e farkl trlerin oluturduu farkl poplasyonlar da bulunur. Ve sonunda bireye (canl organizmaya) gel dik. Yani dorudan can ln n kendisine. imdi ksaca bireyin de detayla rna inerek yaptalarnn neler olduuna bakalm. Organizmalar birbirlerin

24

50 SORUDA YAAMIN TARH

YAAM NEDR?

25

Ancak bu almada sz edilen bakteri, toksik olan arsenikli ortamda yaayarak, bize yaam n snrlarnn d ndm zden ok daha geni olabileceini gsteren bir rnek. Basn toplantsnd a vurgulanan ve b ilim dnyasnda o k ses g etiren asl nem li nokta ise, bak terin in arsen ik li ortam da sadece yaayabiliyor olm as deil; ayn za m anda arsenii yapsna katarak fosforun yerine k u lla n m asdr. Yaplan alm ada, gl ortam ndan izole edilen b ak teriler laboratuvarda fosfor ierm eyen an cak youn a rsenik ieren b ir ortam da bytlm . A ratrm a so n ucuna gre bak teri, n k leik asit (DN A -RN A) ve ATP gibi en tem el yaptalarnda fosforu n yerine arsenii k ullanyor. Bu can llk iin gerekli elem en tler listesin d en fosforu k aracak b ir gelim e olabilir. F o sfo r ile arseniin bu ekild e yer d eitirm esi, yapya k atlan dier tm ele m en tlerin de ben zer biim d e dier baka elem en tlerle y er d eitirm esinin sz k on u su o labilecei anlam na geliyor. B ylece yaam n tanm , tem el yaptalar gibi kavram lar, dndm zden daha da geniliyor. D n ya zerinde yaam n evrim i, dier gezegenlerde yaam aratrm alar, organik kim ya, biyojeokim y asal dng ler, hastalklarn n lenm esi gibi konu lar bu gelim eden etk ilen eb ilir. Ancak unu da belirtm ek gerekiyor ki, NASAn n ak lad bu alm ann devam nn getirilerek, yer deitirme m ekanizm alarnn daha net olarak ortaya konulm as ge rekiyor. Birok bilim insan aratrmada gsterilen k an t larn yeterli olm adn ve arseniin fosforun yerini tama m en karladn kantlam adn ne sryor. Sonu olarak yeni bulu, zerinde phe brakm ayacak ekilde bilim ciler tarafndan sm anm al ve yeni kantlar ortaya konulm al. A ncak bu arada, yaamn ortaya k, uzayda yaam aratrm alar gibi konularda, bu aratrm a da olduu gibi srad durumlarla da karlam a olasl na hazr olmalyz.

Hcrenin temel yaptalar nelerdir? 5 I1 Hcrede bilgi ak nasl olur?


Tm can llar h crelerden olum utur ve h er hcre iinde de saysz m olek l n grev ald karm ak bir sistem devam etm ektedir. Bu karm ak sistem in devam ettirilm esi, organizm ann varln srdrm esini ve sa hip olduu g enetik bilgiyi b ir son raki n esile aktarab il m esini salayacaktr. Bu kargaa ierisind e DNA, RNA ve protein, grev yapan en tem el biyom olek llerd ir ve bu m olek llerin yaplarnn kavranm as, organizm ann atalarndan gelen bilgiyi nasl iled iini ve k end i deva m n nasl saladn anlam am z k olaylatracaktr. En basit ekliyle sylem ek gerekirse, atalarm zdan gelen genetik b ilgi DNAmzda yazldr ve bu b ilgi RNA m o le kl yardm ile okunarak asl igc olan p roteinlerin retilm esi iin kullan lacaktr. im di srasyla bu te m el m olek l n yapsndan ve aralarndaki b ilgi ak n dan bahsedelim . G e n e tik m a lz e m e le r (n k le ik a s itle r) DNA (deoksi ribonkleik asit) hcre iindeki her trl fonksiyon iin gerekli bilginin depoland yerdir. 1953 ylnda nl bilim insanlar Jam es W atson ve Francis C rick, ngiliz bilim kadn Rosalind F ran klin in verilerini yorum layarak DNAnn yapsn ortaya koym ulardr. Bu yap ikili sarmal olarak bilin ir ve karlkl iki DNA zin ci rinin (ipliinin) birbirine balanm asyla oluur. (ekil 7) N kleik asitlerin (DNA ve RNA) en kk yap birim i nkleotit adn alr. Her bir nkleotit bir fosfat grubu, be karbonlu pentoz ekeri ve azot ieren organik b ir bazdan oluur. DNAy oluturan drt farkl nkleotit, ierdikleri farkl baz gruplarna gre adlandrlr. Bunlar adenin (A), guanin (G ), tim in (T) ve sitozindir (C ). Bu temel yap talarnn u uca eklenm esi ile DNA iplii oluur. A ile T balanrken, G ile de C balanr ve balanm a iin kulla nlan hid rojen balar ikili sarm al yapy bir arada tutan tem el kuvvettir.

26

50 SORUDA YAAMIN TARH

YAAM NEDR?

27

Her farkl trn sahip olduu DNA uzunluu birb i rinden farkldr. rnein, E sch ericia coli bakterisinin DNAsnda 4 m ilyon baz bulunur ve bunu dz bir izgide ip gibi uzatacak olursak 1 m m uzunlukta olacaktr. nsan DNAsnda ise bakteriden ok daha fazla sayda, toplam 3 milyar adet baz bulunur. Tm bu bilgiyi yazmak iste sek, 5 00 sayfalk 4 0 0 0 kitap doldurabiliriz. Tm DNAmz hcre iinde 23 krom ozom halinde paketlenm itir ve bir iplik gibi aacak olursak yaklak 1 m etrelik bir uzunluk ta olacaktr. Normal bir insan hcresi ortalama 10 m ik rondur (1 m ikro n = l m /l.0 0 0 .0 0 0 ) ve bu kadar kk bir alana toplam 1 m etrelik DNA paketlenerek smtr. Doal olarak, insann tm hcrelerinde bulunan toplam DNA uzunluu ise ok ok daha fazladr. Bir insanda bu lunan toplam hcre saysn kesin olarak bilm esek de, 50100 trilyon arasnda olduu tahm in edilm ektedir. Her bir hcrede ortalama 1 m uzunluunda DNA olduundan, bir insan vcudunda bulunan toplam DNA uzunluu 50100 milyar km edecektir. Bu uzunluk Dnya ile Gne arasndaki m esafenin 3 0 0 katndan fazladr. RNA (ribon kleik asit) m olekl de, benzer ekilde, nkleotitlerin u uca eklenm esi ile oluur. Her bir nkleotidin yapsnda bir fosfat grubu, be karbonlu bir riboz
ekil 7. Solda, nkleotitlerden oluan iki zincir hidrojen balaryla balanm . P: Fosfat, S: eker, A: Adenin, T: Timin, C : Sltozin, G : G uanin. Sada ise, D N A m oleklnn ikili sarmal yaps ve zerindeki nkleotitler
grnyor.

ekeri ve azot ieren organik bir baz bulunur. DNAda o l duu gibi RNAda da adenin (A ), guanin (G ), ve sitozin (C ) bulunur. Ancak RNAda tim in (T ) baz yerine urasil (U ) bulunur. RNA, DNAdan farkl olarak, hcrede genel likle tek iplik (tek zincir) halinde bulunur. (ekil 8) Hcrede bulunan farkl RNA m oleklleri farkl grev ler iin kullanlr. M esajc RNA (mRNA) ad verilen m o lekl, hcrede protein sentezlenm esi srasnda DNAdan kopyalanan bilgilerin ribozom a tanm asnda grev yapar. Tayc RNA (tRN A), ribozom da protein sentezlenm esi aamasnda amino asitleri getirerek u uca ekleyecektir. Ribozom al RNA (rRNA) ise, protein retim inin yapld organeller olan ribozom larm yaplarnda bulunur ve katalitik grevleri vardr. Bu tem el RNA tipleri dnda zellikle gen reglasyonunda (dzenlenm esinde), DNA replikasyonunda (kopyalanm asnda), mRNA m odifikas yonunda (ilenm esinde ya da deitirilm esinde) grevli birok farkl RNA tipi de vardr. rnein, siRNA, snRNA, snoRNA gibi. Hem DNA hem de RNA tm canllarda b u lunur; canllarn ortak bir atadan trediinin nem li bir gstergesidirler. V irs dndaki tm organizmalarda her iki m olekl de bulunur, ancak virslerde genel olarak bu m olekllerden b ir tanesi bulunur. Virs sadece ekil 8. RNA yaps (mesajc RNA) DNA ya da RNA ierir. rnein, HIV gibi baz virslerde genetik m alzem e olarak sadece RNA var dr.

Proteinler
imdi, hcrenin en tem el m o lekllerinden birisi olan prote inlerle devam edelim. Proteinler hcrenin yaptadr, hcrede saysz grevi yerine getirirler. P roteinlerin en kk yap b iri m i olan am ino asitler birbirine peptit balar ile balanarak uzun

28

50 SORUDA YAAMIN TARH

YAAM NEDR?

29

ekil 9 . Protein yaps: Birincil yap, kincil yap, ncl yap ve drdncl yap.

zincirler meydana getirir. Bu yapya p roteinin birincil yaps ad verilir. Amino asit dizisi nin sras, hcrenin genlerinde yazl olan ifreye gre belir lenir. Am ino asitlerin kendi aralarnda yaptklar hidrojen balar sayesinde proteinin ik in cil yaps ortaya kar. Beta dzlem sel tabaka ve alfa heliks yaplar rnek verilebilir. Bir sonraki organizasyon ise proteinin fonksiyonel olmas iin gerekli olan boyutlu ekli ald yapdr ve ncl yap adn alr. Alfa heliksler ve beta dzlemsel tabakalarn da

d) zellikle hcre zarlarnda bulunan proteinler re sep tr grevi yapar ve dardan gelen uyarlar alg layarak hcrenin uyarya verecei tepkinin gelim esini balatr. Gz retinasnda bulunan rodopsin, gelen alglayabilen bir proteindir. d) H cre iinde ya da h creler arasnda sinyal akta rm n salarlar. B irok horm on protein yapdadr. r nein inslin horm onu kandaki eker seviyesini kontrol eden kk bir proteindir. f) G en reglasyonu da proteinlerin grevleri arasn dadr. DNA zerine balanarak belirli bir genin alm a sn engelleyebilir ya da geni aktif hale getirebilirler. r nein, M etJ proteini DNA zerine balanarak m etionin am ino asitinin sentezlenm esini engeller.

Hcrede bilgi ak - santral dogma


Bu tem el m olekl, yani DNA, RNA ve proteinler d nda, hcrede karbonhidrat, ya, iyonlar gibi saysz m o lekl birlikte alarak hcre ii dzenin devam n salar. A ncak yukarda sraladm z temel biyom olekl, ata larm zdan aldm z bilginin aknda tem el basam aklar oluturur. im di bu bilgi akndan bahsedelim . Hcre iindeki tm faaliyetler, hcrenin sahip olduu genetik malzem ede yazl olan bilgi tarafndan belirlenir. Bu bilginin etkili bir ekilde okunm as ve yorum lanm a s organizm ann devam lln salayacaktr. ekil 10da,
ekil 10. Hcredeki blyopollm er
arasndaki bilgi ak (santral dogm a).

birbirleriyle balanm alar sonucu oluur. Son olarak da drdncl yap gelir. Baz proteinler birden fazla alt b i rim den oluur. Her bir alt birim ncl yapya sahip bir polipeptidtir. (ekil 9) nsanlarda 20 deiik am ino asit bulunur. Bu amino asitlerin protein iinde farkl dizilileriyle her bir protein farkl boyutlu ekillere girer ve bu ekilde de hcre iinde saysz grev alabilir. Hcre iinde retilen prote inlerin yrttkleri grevlerin b ir ksm n yle zetleye biliriz: a) Hcre ve dokularda yapta olarak kullanlrlar. rnein, alfa-keratin salarn yapsnda bulunan bir pro teindir. b) Enzim olarak grev yaparak hcrede gerekleen biyokim yasal reaksiyonlar katalizlerler. rnein, yedii m iz proteinler midede bulunan pepsin enzim i ile para lanr. c) Tayc olarak grev yaparlar. H credeki birok k k m olekl ya da iyonun tanm asndan sorum ludur lar. rnein, kanda bulunan hem oglobin proteini oksijen tanm asnda grevlidir.

hcre inde bilginin ak gsteriliyor. Santral dogma (central dogma) ad verilen ve hcrede bilginin ak yolunu gs teren bu sistem e gre DNAdan RNAya ve ora dan da proteine doru bir gidi vardr. 1) Hcre blnm esi iin , var olan DNAnm oaltlm as gerekir, bu

30

50 SORUDA YAAMIN TARH

YAAM NEDR?

31

ekilde bilgi kopyalanarak yeni hcreye aktarlacaktr. DNAnn oaltlm asna replikasyon ad verilir. 2) DNAda bulunan ve gen ad verilen blgeler kop yalanarak RNAya aktarlr. F arkl RNAlar farkl grevler iin kullanlr. Bu ilem e transkripsiyon ad verilir. 3) H cresel reaksiyonlarda kullanlm ak zere gereken proteinlerin sentezlenm esi iin mRNA zerine yazlan bilgi kullanlr. mRNA ribozom a giderek protein sentez lenm esi iin kullanlr. Bu ilem e de translasyon ad ve rilir. 4) Baz virslerde ise genetik malzem e RNAdr ve b il gi RNAdan DNAya aktarlr. (Ters ynde; rnein, AIDS hastalna yol aan HIV virs gibi.) 5) B irok virs RNA replikasyonu yoluyla RNA m o lekllerini oaltm aktadr. RNAdan RNA sentezini sala yan RNA-baml RNA polim eraz enzim i birok karyot hcrede de bulunur. Buradaki nem li noktalardan birisi, bilgi aknn be lirli bir ynde oluudur. G enel olarak DNAdan proteine doru bir gidi vardr ancak, proteinden proteine ya da proteinden n kleik asitlere doru bir gidi yoktur. Bu tem el m olekl, yani DNA, RNA ve proteinler zerine yaplan alm alar, bilim dnyasn da derinden etkilem i ve b iro k bilim insannn Nobel kazand so nular elde edilm itir. 1962 ylnda Jam es W atson , Francis C rick ve M auri ce W ilkins, Fizyoloji veya Tp N obelini DNAn n kefi zerine daha n ceki alm alaryla alrken, 1 9 6 8 ylnda da ayn dl R obert W . Holley, Har G obind Khorana ve M arshall W . N irenberge genetik kodun yorum lanm a s ve protein sentezindeki fonksiyonu zerine yaptklar alm alar nedeniyle verildi. RNA zerine yaplan al m alar da birok bilim insanna Nobel dl getirdi. s panyol bilim adam Severo O choa 1959 ylnda Fizyoloji veya Tp Nobel dln RNA sentezleyen polinkleotit fosforilaz enzim ini bulduu alm asyla kazand (dl Arthur Kornberg ile paylam t). Enzim in aslnda RNA sentezinde deil, paralanm asnda grevli olduu ortaya

karlacakt. Fizyoloji veya Tp Alan N obel dln 1 9 6 8 de R obert Holley (Har G obind Khorana ve M arshall N irenberg ile paylat) maya tRNAsm m nkleotit bazla rn diziledii alm asyla, 1975 ylnda David Baltim ore, Renato D ulbecco ve Howard Tem in RNAdan DNAya bil gi akn salayan ters transkriptaz (reverse transcriptase) enzim ini kefettikleri alm alaryla, 1989 ylnda T h o mas C ech ve Sidney Altm an katalitik RNAy kefettikleri daha nceki alm alaryla, 1993 ylnda Philip Sharp ve Richard Roberts intron ve RNA ilenm esi(1) bululary la, kazandlar. 2 0 0 6 ylnda Andrew Fire ve Craig M ello RNA interference (engellem e) zerine alm alaryla Tp veya F izyoloji Nobel dln alrken, Roger Kornberg ise ayn yln Kimya Nobel dln RNA transkripsiyo nu zerine alm asyla ald. Frederick Sanger ilk defa bir proteinin (ins linin) am i no asit dizisini ortaya kard alm as nedeniyle 1958 ylnda Kimya Nobel dln alrken, M ax Perutz ve Jo h n Cowdery Kendrew hem oglobin ve m iyoglobin pro teinlerinin boyutlu yaplarn ortaya kardklar iin 1962 ylnda ayn dl paylatlar.

1) n tr o n : RN A d an k o d la n m a d a n a tla n k sm . E x o n : RN A da k o d la n a n k sm . R N A i le n m e s i (R N A s p lic in g ) : RN A dan in tro n la rn k a rlp e x o n la rm b irle tirilm e s i.

CANLILARIN SINIFLANDIRILMASI

33

3.

Blm

CANLILARIN SINIFLANDIRILMASI

1Canllar I nasl snflandrlr?

Gnm zde isim lendirilebilen farkl tr says 2 m il yona yakndr. Var olduu tahm in edilen tr says ise bundan ok daha fazladr. Peki, bu kadar fazla saydaki organizmay birbirleriyle ilikilerine, yaknlklarna ve akrabalk derecelerine gre nasl ayrabiliriz? Bu ura binlerce yl ncesinde ortaya kt ve zamanla gelierek bugnk m odern snflandrm a sistem lerini oluturdu. Yzyllar boyunca, doa aratrm alarnn en tem el bilee ni, organizm alar snflandrm ak olm utur. Tarih boyunca snflandrm a yntem lerinin srekli bir deiim halinde olduunu grrz. Yeni bulgular deiik sistem lerin ne srlm esine yol am tr. Bugn bile b ir den fazla snflandrm a sistem i kabul grm ektedir. G ittik e daha iyi bir snflandrm a sistem ine doru gidi olsa da, h er sistem deiikliklere aktr. B ilinen ilk snflandrm a m etodunu Aristoteles (M 3 8 4 -3 2 2 ) getirm itir. C anllar ok tem el gzlem lenebilir fiziksel zelliklerine gre b itkiler ve hayvanlar olarak iki

34

50 SORUDA YAAMIN TARH

CANLILARIN SINIFLANDIRILMASI

35

L m m rn .
| A lem

B enzerlik aza lir, birey says artar. | ube Snf Takm i A ile ; | Cins | Tr

edilm esinin bir sonucu olm utur. imdiye kadar b ilinm e yen yeni bir dnya, insanoluna alm ve m ikroskobun daha da gelitirilm esiyle birlikte tekhcreli organizm ala rn incelenm esi kolaylam tr. Canllar arasndaki eitliliin anlalm asndaki en nem li adm lardan birisi, 19. yzylda Ingiliz doa b ilim ci Charles Darwin tarafndan atld. 1 8 5 9 da yaymlad Trlerin K ken i isim li eseriyle, tm canllarn ortak bir atadan trediklerini ve evrim sel deiimin m ekanizm as nn da doal seilim olduunu ortaya koydu. Darwinin zam anndan sonra, zellikle 20. yzylda evrim kura m nn daha iyi anlalm asyla birlikte, canllar snflan drrken evrimsel akrabalklarn kullanld filogenetik snflandrm a geliti. Ancak canllar arasndaki evrimsel akrabalklarn snflandrm ada kullanlm as 1 9 7 0 lerden sonra oldu. 20. yzyln ortalarnda Am erikal biyolog Herbert Copeland (1 9 0 2 -1 9 6 8 ), snflandrm aya bir de bakteri ler lem ini ekleyerek, canllar drt lemde gruplam tr. Tekh creli karyotlar ile prokaryotlarn birbirinden fark larnn belirginlem esi ile snflandrm ada ayr bir lem daha alm tr. 1969 ylndaysa Amerikal bitki bilim ci Robert W h itta ker (1 9 2 0 -1 9 8 0 ), m antarlar lem ini de (tek ya da okhcreli karyotik canllardr) ekleyerek, be lemli snflan drmaya gem itir. (ekil 12) Yine bu snflandrm ada da,
ekil 12. VVhittaker'n ne srd snflandrm a sistemi, canllar be
lem de grupluyor.

................. .................. ... ....... .................


B enzerlik a rta r, birey says azalr.
ekil 11 . Unnaeus snflandrm a sistemine gre hiyerarik canl gruplar.

tem el gruba ayrm tr. Alt gruplara ayrm ak iin de can l hareketlerini gzlem lem i ve havada uabilenler, suda yzebilenler ya da karada yaayanlar eklinde bir snflan drmaya gitm itir. Devam eden yzyllarda b iro k b ilim insan ca n lla rn sn flan drlm asn a k atk salasa da, m odern takson o m in in (snfland rm a b ilim i-sistem atik ) ortaya k n sveli b ilim insan C arolus Linnaeus (C ari von Lin n e olarak da b ilin ir, 1 7 0 7 -1 7 7 8 ) salam tr. 1735 ylnda yaym lad S ystem a N a tu ra e isim li k itabnd a L innaeus sn flan d rm as olarak b ilin en b ir yntem getirm iir. C anllar tem el olarak iki lem e (b itk ile r ve hayvanlar) ay rm tr, ancak her lem ierisin d e de hiy erarik bir organizasyon em as gelitirm itir. O rganizm alarn pay latklar fiziksel zelliklere gre ay rld klar bu h iy erar ik gruplar srasyla; lem , u be, sn f, takm , aile, cins ve trdr. st ksm da bu lu nan lem , ube ve snfta daha fazla organizm a bu lu n u rk en , organizm alar aras b en zerlik daha azdr. H iyerarinin alt tarafnda b u lu nan aile, cins ve tre gelindiinde ise organizm a says azalrken b en zerlik artm aktad r. Bu snflandrm a genel olarak, can llar, gzlem len ebilir fiziksel (m o rfo lo jik ) zelliklerin d eki ben zerliklere gre gruplara ayrm akta dr. ( ek il 11) 19. yzylda Ernst H aeckel (1 8 3 4 -1 9 1 9 ), canllar

Canllar M oneralar
:

lem altnda toplamtr: Bitkiler, hayvanlar ve protistalar (tekhcreli karyot ve prokaryotlar ieriyordu). Bu snf landrma da gzlem lenebilen fiziksel zellikler kullanla rak yaplm tr. Protistalarm eklenm esi m ikroskobun icat

\ 4 Hayvanlar
j B itkiler M antarlar

Protistalar

CANLILARIN SINIFLANDIRILMASI

37

36

50 SORUDA YAAMIN TARH

ralya okul kitaplarnda be lem li snflandrm a sistem i gzlem lenebilir fiziksel zelliklerin karlatrlm as etkili olm utur. Be lemli snflandrm a, baz deiikliklerle b ir likte, birok alm ada kullanlm aya devam edilmektedir. Bu zamana kadar canllarn snflandrlm asnda benzer yntem ler takip edilm itir. Bilim ilerledike daha detayl gzlem ler yaplsa da, canllar tem el olarak benzer fiziksel (m orfo lojik) zelliklerine gre gruplandrlm tr. C a ri W o e se ve y en i s is te m le r 1977 ylnda Amerikal mikrobiyolog Cari W oese (1 9 2 8 -), W hittakern nerdii be lemli snflandrmada bulunan bakteriler lemini ikiye ayrarak, toplam lem saysn altya karmtr. Bitkiler, hayvanlar, mantarlar, protistalar, bakteri lemi (tekhcreli prokaryotlar) ve arkebakteriler (prokaryot yapda, ancak bakterilerden ok karyotlara benze yen tekhcreli canllar) olarak yaplandrlmtr. (ekil 13) Buradaki snflandrma, canllar arasndaki evrimsel akrabalklar ve molekler genetik verileri ierir. W oese, zellikle ribozomal RNA almalarndan elde edilen ve canllarn birbirleriyle olan akrabalklarn gsteren bulgu lar kullanmtr. Farkl Canhlar organizmalar m orfolojik ; \. olarak benzer grnme karyotlar Bakteriler se de, hcresel seviye de gen yaplar, protein Arkealar yaplar, m etabolik yol ekil 1 3 .1 9 9 0 ylnda, C ari Woese tm izleri vb. benzerlik iere canllar st-lemde top la d. bilir. zellikle arkealarla birlikte, snflandrmada lemden daha yukarda bir grubun ihtiyac olumutur. 1990 ylnda Cari W oese, tm canllar temel st lemde (domain) gruplandrmtr. Bakteriler, karyotlar ve arkealar. Bu sistemde, alt lemli snflandrma sisteminden vazgeilmemitir, ancak karyotik lemler tek bir atda toplanmtr. Bu sistemde arkealarm karyotlara olan yaknl bakterilere olan yaknlndan daha fazladr. Gnm zde farkl lkelerin okul kitaplarnda, farkl s nflandrm a yntem leri anlatlm aktadr. rnein ABDde alt lem li snflandrm a retilirken, Ingiltere ve Avust retiliyor. M odern snflandrm a sistem leri, organizm alar arasn daki evrim sel yaknl tem el alm aktadr. Organizm alar hakknda daha fazla bilgi edindike, snflandrm a em a lar deim ekte ve yeni akrabalk dereceleri ortaya k arl maktadr. zellikle getiimiz yzylda, hcre biyolojisi, m olekler biyoloji, m olekler genetik, biyokim ya ve ev rim alanlarndaki gelim eler organizm alarn birbirleriyle olan ilikilerini anlamam z kolaylatrd. Snflandrm a sistem lerinde yaanan tem el deiiklikler de, bu yeni b i lim alanlarndaki gelim eleri takip etm ektedir. A ristotelesden gnmze kadar gelen tm snflan drma sistem leri, kendi bulunduklar dnem lerde doru olarak kabul edilmi ve kullanlm tr. Ancak bilim sel ge lim eler sonucu canllar hakknda daha fazla bilgiye sahip olunm asyla birlikte, snflandrm a sistem leri de farklla arak daha salam tem ellere oturm utur. zellikle canl larn genetik yaplarnn ve evrimsel yaknlk d ereceleri nin ortaya karlm asyla birlikte, soyaalar daha doru ve detayl olarak oluturulabilm ektedir. F ilo g e n e tik sn fla n d rm a Filogenetik snflandrm a, organizm alar arasndaki evrimsel yaknl gsteren bir snflandrm a sistem idir. Linnaean snflandrm asna gre iki tem el avantaj ierir: ncelikle her organizm ann evrim sel tarihi hakknda bilgi verir. k in ci olarak da, Linneaen snflandrm asnn yapt gibi organizm alar belirli gruplar halinde (lem , snf, takm vb.) derecelere ayrmaz. Linnaean snflandr mas canllar arasndaki evrim sel akrabalklara dayanma d iin , birok bilim insan filogenetik snflandrm ay kullanm aktadr. Canllar arasndaki evrimsel akrabalklar aratrrken, filogenetik aa ad verilen diyagram -izim ler kullanlr. Diyagram zerinde birok dal bulunur. Bir grup ikiye ay rldnda iki daln ayrm noktas bir dm noktasdr ve zaman olarak bu noktadan sonra iki grubun farkl ynlere

38

50 SORUDA YAAMIN TARH

CANLILARIN SINIFLANDIRILMASI

39

doru deitiini gsterir. Her bir organizma ise dallarn en ularnda bulunur. ki farkl daldan geriye doru gi decek olursak, o iki organizm ann sahip olduu ortak ataya ularz. Filogenetik snflandrm a yapldnda, Linnaean s nflandrm asnda kullanlan birok ikili adlandrma ayn ekilde kullanlm aktadr. Akrabalk dereceleri de uyum ludur. A ncak baz durumlarda iki snflandrm a sistem i n in uyumad noktalar vardr. rnein, kular evrimsel olarak srngenlerle yakn akrabadr. Filogenetik aata ise, kular srngenlerin iinde gsterilir. Tm canllar gsteren filogenetik aa deiiklie ak bir em adr. (e k il 14) Yeni bulgular canllarn birbirleriyle olan evrimsel akrabalk derecelerini daha netletirm ektedir.

me sistem i kullanlm aktadr. 19. yzylla birlikte canlla rn zellikle hiyerarideki st gruplandrm alar deiikli e uramaya balam tr.

1Dnya zerinde isimlendirilebilen I canl tr says katr?

Dnya zerinde yaamn ortaya kt ilk andan iti baren geen m ilyarlarca yl boyunca, yaam eitlenerek gelim i ve m ilyonlarca farkl yaam form u oluturm u tur. Gzmz evirdiimiz her yerde farkl organizm a trleriyle karlasak da, tanm layabildiim iz tr says dnya zerinde var olan toplam tr saysnn yannda ok azdr. 2 0 0 0 ylnda, Birlem i M illetler tarafndan olu turulan M ilenyum Ekosistem D eerlendirm esi (T h e M illenium Ecosystem A ssessm ent), insanlarn ekosistem zerindeki etkilerini ve var olan ek o lo jik sistem lerin sr drlebilm esi iin gerekli bilim sel adm lar aratrm akta dr. Dnya apnda 1 3 6 0 tan fazla bilim insan bu deer lendirm enin oluturulm as iin ortak olarak alm akta ve belirli aralklarla kardklar raporlarla dnya zerindeki ekosistem lerin durum unu ve yaplm as gerekenleri ortaya koymaktadr. 2 0 0 5 de yaym lanan deerlendirmede, dnya zerinde ki isim lendirilebilen toplam tr says yaklak 2 m ilyon olarak verilm itir. Bu say sadece tanm lanabilen trlerin saysdr. Toplam tr saysnn ise 5 -3 0 m ilyon aras oldu u tahm in edilm ektedir. Grdnz gibi, tr saysn tam olarak sylem ek pek m m kn deil. Egzotik orm anlarda kefedilen yeni tr lerle ilgili haberler ok sk olarak karm za km aktadr. Bu yzden, tanm lanabilen tr saysnda srekli bir art vardr. A ncak saydaki bu art da ok salkl olm ayabi lir. Bilinm eyen bir tr, dnyann farkl yerlerinde farkl bilim insanlar tarafndan kefedilip farkl isim lerle kayt

kili adlandrma
Carolus Linnaeus ayn zamanda canllar isim lendir m ek iin Latince iki isim den oluan ve ikili adlandrma (binom ial nom enclature) ad verilen bir sistem olu tu r mutur. Her bir canl tr bu yolla isim lendirilir ve ev rensel olarak bu isim ler geerli kabul edilir. lk isim trn ait olduu cinsin addr, ikinci isim ise o tr iin verilen zel isimdir. kinci isim , tr kefeden bilim insannn ya da ilk kefedildii yerin onuruna da verilebilir. rnein F elis catu s ev kedisinin tr addr. F e lis bu trn ait olduu cinsi gsterir. Gnm zde baz deiiklikler olsa da, ayn isim lendirekil 14. Yaamn filogenetik aac.
BAKTERLER ARKEALAR KARYOTLAR

Spiroketler

Yeil filamenlli b^ teri

\ Gra!L . Proteobakteri Pozl,l,ler Siyanobakteri \ I Planktomiset Bakteroides cytophaga Thermotoga Aquifex

Amipler Mantarlar Ha>'vanlar \ / /M a n ta rla r Methanosarcino Methanobacte^al Bitkiler H a lo fille r \ L Methpnotoccus ' Kirpikliler T. celer\ ^ K a m lla r ''Tritho monad ^Microspordae ' Diplomonad

Jhermoproteus \ \ / iPyrodicticum ^ y

40

50 SORUDA YAAMIN TARH

EVRM

41

altna alnm olabilir. Bu gibi hatalarn gzden geirilm e si ve snflandrm a kategorilerinin yeniden dzenlenm esi zaman alacaktr. Trlerin dnya zerindeki dalm lar eit deildir. Tanm lanabilen trlerin yzde 7 0 i sadece 12 lkede bulunur. Bu lkeler Avustralya, Brezilya, in, Kolom biya, Ekvator, H indistan, Endonezya, Madagaskar, M eksika, Peru ve Zairedir. T ekn o lo jin in gelim esiyle b ir likte, ulam m zn az olduu kutup blgeleri ya da ok yanus dipleri gibi alanlara daha rahat ulalm akta ve bu blgelerde b iro k yeni tr ortaya karlm aktadr. M em eli hayvanlar, kelebek, ku, bitk i ve b cek trleri iyi allm tr. sim lendirilen trlerin yarsndan fazlas b cek trleridir ve bunlar iinde de yaklak 3 0 0 .0 0 0 k e lebek tr bulunur. Burada saylarn verdiimiz trler arasnda tekhcreli canllar bulunm am aktadr. rnein, bakterilerde bildii miz anlamda bir tr tanm n yapmak daha zordur. K o layca tarif edilebilecek zelliklere ya da bir poplasyon yapsna sahip deillerdir. Bakterilerde tr tanmndan bahsettiim izde, daha ok 16-S rRNA(2) dizisindeki yksek benzerlikten bahsederiz. Bu ise olduka zor bir snflam a yntem i olacaktr. Bilinen 9 0 0 0 e yakn farkl bakteri tr olsa da, gerek rakam 10 m ily on -1 m ilyar arasnda olabi lir. Bu yzden bu noktada sorulm as gereken ka farkl tr bakteri olduu deil, ka farkl fonksiyonda bakteri grubu olduu olabilir. Arkealar iin de durum benzerdir. Belirlenen ube says 8 olsa da, tahm in edilen 1 5 -1 8 ube bulunduudur. Bunun yannda tr says ise tahm in edil m ekten ok uzaktr.

4. Blm EVRM

1Canllar I nasl eitlenmitir?

Dnya zerinde canllarn nasl eitlendiini ve n ceki trlerden yeni trlerin nasl ortaya ktn anlatan bilim sel teori evrim teo risid ir (teori=kuram ). Bu teori, yzlerce yldr elde edilen bilim sel bulgularn desteiyle gelitirilm i ve canl eitliliini anlatan en geerli teori halini alm tr. Gnm zde bilim insanlar evrimin var olup olm adn tartm yor. Bunun yerine, evrimin m e kanizm alarm daha detayl bir ekilde ortaya karm ak iin urayorlar.

Evrim nedir?
B iy olojik evrim, basit bir anlatm la, deierek rem ek (descent w ith m odification) olarak tarif edilebilir. Kk apta, m ikroevrim diyebiliriz, bir poplasyonda nesilden nesile meydana gelen gen frekanslarndaki deiikliktir. Byk apta ise, buna da m akroevrim diyebiliriz, ortak bir atadan birok nesil sonrasnda yeni trlerin trem e sidir. Bu teorinin tem elinde, dnya zerindeki tm canllarn ortak bir atadan tredii fikri yatar. Her canl tr birbiriyle akrabadr. Bazlar daha yakn akraba iken, bazlar

2 ) 1 6 -S rR N A (R ib o z o m a l R N A ): P ro k ary o t h cre le rd e , rib o z o m la rd a b u lu n an b ir RNA l r d r. F a rk l b a k te ri ve ark e a t rlerin d e y k s e k o ran d a d e im e d e n k ald i in ev rim sel a k ra b a lk la rn b e lirle n m e s in d e k u lla n lr.

42

50 SORUDA YAAMIN TARH

EVRM

43

arasndaki akrabalk daha uzaktr. Tm can llar birbirin in uzak k u zenleridir diyebiliriz.
1 ) K p e k b a lk lo 2 ) K e m ik li b e lik le r 3 ) A m fib ile r 4 ) P rim o lo r 5 ) K e m irg e n ve ta v a n la r 6 ) T im s a h la r

O rto ko ta

7 ) D in o z o rla r & k u la r

ekil 15. Filogenetik soyaacnda


aadan yukarya doru yol aldka, ortak atadan treyen farkl canl gruplarna varrz. Her dallanm a bizi farkllaan bir gruba gtrr.

ekil 15de, canl lar arasndaki evrim sel akrabalk derecesini gsterm ekte kullanlan filogenetik soyaac g rlm ektedir. Tm canl gruplarn kapsamasa da, farkl organizm a larn birbirinden nasl

ayrldn ve birbirleriyle nasl balantl olduunu gre bilirsiniz. nsanlar da prim at01 takm ierisinde yer alr.

1Evrim fikri nasl ortaya kmtr I ve gelimitir?

Evrim kuram denildiinde aklm za ilk gelen isim , b yk olaslkla ngiliz bilim insan Charles Darwindir. D ar win, evrim le ilgili en bilinen isim olm utur, ancak evrim kuram n oluturan fikirler Darwinden yzlerce yl nce ortaya km aya balam tr. Paleontoloji, hcre biyolojisi, biyocorafya ve je o lo ji gibi farkl bilim dallarndaki geli m elerin de katksyla evrim fikri Darwinden sonra da e killenm eye devam etm i ve zellikle 20. yzylda genetik bilim inin katklaryla bugnk halini almaya balam tr.

toteles ve devam eden alarda da dier Egeli, Romal, inli filozoflar ve slam filozoflarnn, canllarn dnya zerinde ortaya klar ve deiim leri zerine fikirler ge litirdikleri biliniyor. Bu dnem lerde yaygn olarak kabul edilen fikirler arasnda, canllarn zaman ierisinde dei im e uram adklar, Dnyanm sadece binlerce yldr var olduu ve oluum unun bir haftada tam amland ve h i bir canl trnn yok olmad fikirleri bulunuyor. Buna ek olarak, zellikle dini kitaplarn da etkisiyle, tm can l larn birer am a iin yaratld fikri hkim di. MS 14. yzylda karlatrm al anatom inin gelim e siyle birlikte, insan vcudunun daha detayl olarak in celenm eye balanm asyla, insann ok da zel bir canl olm ayabilecei fikri gelim eye balad. 15. yzylda Da nim arkalI b ilim ci N icholas Sten onun alm alar paleon to lo ji b ilim in in ortaya km asn salad. Steno, fosillerin bir zam anlar yaam , ancak soylar tkenm i canllardan kaldn ve st ste sralanm toprak katm anlar arasn da, b ir zaman srasna gre dizildiklerini ne srm t. zellikle 18. yzyl sonrasnda k ozm o lo ji ve fizik alann daki gelim eler, doa bilim lerin i de etkilem eye balad. Daha nce sz ettiim iz gibi, sveli b ilim ci C arolus Linnaeus, canllarn snflandrlm as zerine A ristotelesden beri gelen sistem i deitirerek yeni bir snflandrm a sis tem i getirdi ve bu sistem de, insanlar ilk defa olarak pri m atlar arasnda yerini ald. Bu dnem de doa bilim ciler, trlerin deiebileceini ve hatta yok olabileceini ne srd. Biyoloji alanndaki bilgilerin artm asyla birlikte, bilim ciler yeni evrim sel fikirler de ortaya srmeye balam tr. Bu doa bilim cileri arasnda Charles Darwinin dedesi Erasm us Darwin ve Fransz doa bilim ci Jean-Baptiste Lam arck da bulunuyor. zellikle Lam arckn evrimsel fikirleri byk yank uyandrm tr. Lam arckn fikirleri arasnda, kullanlan organlarn gelim esi ve bu zelliin gelecek nesillere kaltm yoluyla aktarlm as da vard. Trler yok olm uyordu, ancak b irbirine dnyordu.

Darwin ncesi
Dnya zerindeki canllarn nasl trediklerini anla maya alan fikirlerin ortaya k M 6. yzyla kadar gidiyor. Antik Egeli filozoflar Anaxim ander, Platon, Aris
3 ) P rim a t: M e m eli s n fn a ait, in san n da d ah il old u u tak m d r. B u tak m d a b u lu n a n la r a rasn d a g o ril, o ra n g u ta n , em p a n z e , g ib o n ve b e n z e r i t rler vardr.

44

50 SORUDA YAAMIN TARH

E V R M

45

Charles Darwin
Darwinin evrim zerine gelitirdii fikirlere gem e den nce, hayatn ksaca gzden geirm ekte fayda var. Bulunduu evre, oku duu okullar ve tabii ki katld geziler, Darwinin grlerini derinden etkile mi ve ne srd evrim kuram na giden yolu a m tr. (ekil 16) eki| 16 Char|es Robert Darwin Charles Robert Darwin, (12 ubat 18 09 - 1 9 Nisan 1882). 1 8 0 9 da Ingilterede dodu. Babas Robert Darwin zengin bir doktor ve finansyd. Baba tarafndan dedesi olan Erasm us Darwinin evrimle ilgili fi kirleri vard. Charles Darwin, Edinburgh niversitesinde tp okumaya balad, ancak dersler ve cerrahi ilem ler ilgi sini ekm iyordu. Bunun yerine doa tarihi zerine alan gruplara katld, deniz omurgaszlaryla ilgili almalarda yer ald ve zellikle Lam arckm evrim fikirleriyle ilgilen di. niversite mzesinde yapt bir almada, bitkilerin snflandrm asn da rendi. Tp eitim inden bu ekil de uzaklamas yznden babas, Charles Darwini rahip olmas iin Cambridge niversitesine gnderdi. Burada okuduu dnem boyunca, zellikle W illiam Paleyin do al teo lo ji fikirleriyle ilgilendi. Doal teolojide tem el ola rak, Tanrnn bykln ortaya koym ak iin canllarn dnya zerindeki dalmlar ve oynadklar roller arat rlyordu. Darwin, kuzeninin etkisiyle bcek trleri top lamaya balad, hatta bulduklarn baz bilim sel dergilerde yaymlama ans da buldu. Bu srada Kaptan Robert FitzRoy ynetim indeki HM Beagle isim li gemi Gney Ame rika kylarnn haritasn karm ak amacyla dem ir alma hazrl yapyordu. Darwine bu geminin doa bilim cisi olmas iin bir teklif getirildi. Darwinin babas ilk balarda kabul etm ese de, Darwinin days Josiah W edgewoodun onu ikna etmesiyle, Charles Darwin iki yl srmesi bek

lenen bu geziye katlm a iznini ald. (ekil 17)

Beaggle gezisi
Charles Darwin, HMS Beagle gem isiyle 183118 3 6 yllar arasnda be yl boyunca dnyay do lat. Zam annn byk ounluunu, uradk lar yerlerdeki je o lo jik

yapy inceleyerek ve HMS Beaggle gemisi. doal tarih koleksiyon lar yaparak geirdi. Dzenli olarak notlar tuttu ve topla d rnekleri de aralklarla Ingiltereye gnderdi. Gney Am erikay dolanarak Brezilya ve iliye de uradktan sonra Galapagos Adalarna ulatlar. Darwin, gezi boyun ca canl trlerinin bulunduklar ortam a gre nasl farkl latn, tropik orm anlarn gzelliklerini, insanlarn k lelere yaptklar zulm leri, toprak rtsnn deprem lerle nasl ekillenebildiim ve fosil rneklerinin bulunabildii farkl ortam lar gzlem ledi. (ekil 18) Canllar leminde var olan yaam savana kendi gzleriyle ahit oldu. 1836 ylnda Londraya ulatklarnda Darwin, yolculu u boyunca geri gnderdii m ektuplar sayesinde tannm
ekil 1 8 . HMS Beaggle'n be yl boyunca izledii rota ve urad limanlar.

ekil 17. D arw in'in be yln geirdii

46

50 SORUDA YAAMIN TARH

EVRM

47

bir doa bilim ciydi. Bu dnem de farkl bilim cilerle tanma ve fikirlerini gelitirm e frsat bu l du. 1830larm sonlarna doru kendi evrim kuram n olutur maya balad. G vercin yetiti ricileriyle uzun zaman geirm i ve onlarn belirli zellie sahip gvercinleri nesiller boyunca nasl setiklerini renm iti. rn e in daha uzun boyunlu ekil! 9. A |fred Russel Wallace gvercinler seilerek retilirse, (8 Ocok! 823. 7 Kasm , 913) nesiller sonrasnda sadece uzun boyunlu gvercin elde edilebiliyordu. nsan eliyle yaplan bu bilinli seim in bir benzerini, doa bilinsizce de olsa yapyor olabilirdi. Eer yeterince sre verilecek olursa, doa da istenilen baz zelliklerin ortaya km asna neden olabilirdi. Darwin devam eden 20 yl boyunca, evrim kuram ve doal seilim zerine alm ay srdrd. Fikirlerini ak lam adan nce m m kn olduunca fazla miktarda kant elde etm ek istiyordu. Bu yllar boyunca dnyann farkl yerlerinde alan bilim insanlaryla da fikirlerini payla m t. Bunlardan birisi de Gney Amerika ve Asyada ara trm alar yapan ngiliz bilim insan Alfred Russel W allace idi. W allace biyocorafya zerine alyordu ve trlerin dnya zerindeki dalm larn anlamaya alyordu. Bir yandan da bulduu farkl tr rneklerini Darwine gnde riyordu. (ekil 19) W allace, 1 8 5 8 ylnda, evrim zerine kendi gelitirdii fikirleri bir m ektupla Darwine gnder mi ve fikirlerinin yaym lanm as iin Darwinden yardm istem iti. Darwin m ektubu aldnda byk bir o k geir m iti; nk W allacein fikirleri Darwinin yllardr olu turduu evrim kuram ile neredeyse bire bir aynyd. C harles Lyell ve Joseph D alton Hooker tarafndan Londrada bulunan Linnaean Bilim Topluluunda dzen lenen bir toplantda, Darwin ve W allacein fikirleri ayn anda grld ve bu fikri ilk olarak kim in ortaya att

saptanmaya alld. Darwin fikirleri zerine 20 yl akn bir sredir alyordu ve bu yzden de Darwinin daha nceden bu fikirleri oluturduu fikri kabul grd. D ar win, nl kitab T rlerin K k en ini 1 8 5 9 ylnda yaymla d. W allace ise gezilerine ve biyocorafya zerine yapt alm alara devam etti. Charles Darwinin en belirleyici zellii, o gne kadar yaplanlardan ok daha net bir ekilde evrim kuram m or taya koym as ve evrimin itici gc olarak doal seilim i tanmlam asdr. Trlerin K ken i, tm zamanlarda yaym lanan bilim sel kitaplar arasnda hem en fazla sat rakam na kan ve hem de en fazla etki yaratan kitaplardan birisi oldu. Yl lar ierisinde bilim insanlarnn ou evrimi ve canllarn ortak atadan gelm i olduklar fikrini kabul ettiler. Doal seilim fikrinin kabul edilm esi daha uzun zaman alsa da, zellikle 20. yzylda krom ozom larn ve genlerin kefi ve genetik bilim inin gelim esiyle birlikte doal seilim in ka bul de kanlm az oldu.

Darwin sonras
Darwin evrim in m ekanizm as olarak doal seilim i tanm lam t, ancak kaltsal eitliliin kaynan ortaya koyamyordu. O da Lam arck gibi, ebeveynlerin yaam boyunca kazandklar zelliklerin yavrulara aktarldm dnyordu. Ancak bu yanl bir dnceydi. 1 8 8 0 li yllarda Alman biyolog August W eism ann, kullanm a-kullanm am a yoluyla kazanlan zelliklerin yav rulara aktarlm adn ortaya kard ve bu, Lam arck d ncenin de sonunun balangc oldu. 1865 ylnda, ek rahip, bilim insan G regor M endel, bezelyelerle yapt deneylerle genetik bilim inin tem ellerini ortaya koym utu, ancak deneylerini tam amlayamad. M endelin deneyleri nin nem i, 1 9 0 4 ylnda tekrar kefedildiinde anlalacak t. (ekil 2 0 ) M endelin alm alarnn HollandalI bilim ci Hugo de Vries tarafndan yeniden kefiyle trde bulunan bireylerin sahip olduklar genetik eitliliin anlalm a snda nem li bir adm atlm oldu. Darwin ve W allace,

48

50 SORUDA YAAMIN TARH

E VR M

49

M endelin yaptklar deneylerden de genetik bilim inden de haberdar deillerdi. De Vries ve dier ilk ge netikiler doal seilim i dorudan desteklem ese de, genetik bilim i do al seilim iin gerekli olan kaltsal eitlilie kaynak sunuyordu. Doal seilim yoluyla evrim fikri hi olm a d kadar kuvvetlenm iti. 20. yzylda zellikle Alman j e ofiziki Alfred W egenerin alm a lar ile D nya'nn deiken olduu ve ktalarn yava da olsa hareket ettii ortaya karld. Radyom etrik tarihlem enin gelitirilm esi ile kaya larn ve fosillerin yalar llebilir hale geldi. Bylece, Dnyann san landan ok daha eski olduu ortaya

1 O I Evrim 'n alm a

I \ J I mekanizmas nedir?

Canllardaki evrimsel deiimin tem elinde, bir poplasyonda yaayan bireyler arasnda bulunan genetik fark llklarn bir sonraki nesile aktarlm as gelir. Poplasyon ierisindeki genetik eitlilii etkileyen temel faktrler arasnda m utasyonlar, genetik rekom binasyon, poplasyonlar aras gler ve genetik srklenm e saylabilir. Doal seilim , cinsel seilim ve birlikte evrim lem e (coevolution) ise bireyler arasnda bulunan farkllklarn se ilm esini salayan temel m ekanizm alardr. P o p la sy o n u n b ire y le ri a ra sn d a e itlili i sa la y a n fa k t rle r M utasyon: Canllarn tem el kaltm m ateryali olan DNAda meydana gelen deiikliklere m utasyon ad ve rilir. C anlnn sahip olduu DNAs, o canlnn yaam nn tm aam alarn, eklini, fonksiyonlarm , devamlln vb. etkileyecei iin DNAda meydana gelen deiiklikler canl asndan k ritik nem tayabilir.
ekil 21 . DNA'nn yapsnn ortaya karlm as, evrim kuramn destekleyen yeni bilimsel alma alanlarnn olumasn da salad.

ekil 20. Mendel deneylerinde dzgn ve buruuk bezelyeleri aprazlayarak, nesiller


boyunca elde ettii bezelyelerin yapsn kontrol ediyordu.

km oldu. 1 9 2 0 li ve 1 9 3 0 lu yllarda zellikle J. B. S. Haldane, Seawall W right ve Ronald Fisher gibi bilim insanlar, Darwinin evrim fikirleri ile genetik bilim inin bulgularn bir araya getirerek m odern evrim sentezini oluturdu lar. 1 9 4 0 larda DNAnm kefi ve 1953 ylnda da Jam es W atson ve Francis C rickin Rosalind F ranklinin verilerini kullanarak DNAnn yapsn kefetm esiyle birlikte, kal tm iin fiziksel k ant da gsterilm i oldu. O zamandan beri de genetik ve m olekler b iyoloji, evrim sel biyolojinin tem elini oluturdu. (ekil 2 1 ) Bu alanlarda yaanan hzl gelim eler, insann ve binlerce dier trn genom larnn okunm as ile birlikte, evrim kuram hi olmad kadar gl b ir kuram halini alm tr. Gnm zde evrim biyo lo jisi ierisinde biyokim ya, ek oloji, genetik, fizyoloji, tp, felsefe ve bilgisayar bilim lerini bulabilirsiniz. 21 . yzylda evrim le ilgili alm alar hzla devam etm ektedir.

Hcre blnm esi srasnda DNA kopyalanarak oaltlr, ancak bu ilem bazen hatal gerekleebilir. Bu hata eer hzl bir ekilde d zeltilm ezse, yeni yaplan DNA ilk DNAdan farkl olacaktr. Bunun dnda d faktrler de DNA di zisinde m utasyona neden olabilir. Baz kim yasallar ya da radyasyon, DNA zincirinin krlm asyla, m u tasyon olum asna neden olabilir. Y ksek m iktarda maruz kalnan UV n da DNAda deiiklie neden olacaktr. Bu yzden zel likle yaz aylarnda, gne nlar nn etkili oduu saatlerde glge de durulm as nerilir. (ekil 2 2 )

50

50 SORUDA YAAMIN TARH

EVRM

51

nce

J )

Sonra

uv
n

ekil 2 2 . Yksek m iktarda maruz


kalnan UV n D N A'da deiiklie neden olacaktr.

O luan m utasyonlar trn bireyleri arasnda genetik eitlilik yara tacaktr. Trne gre zararl, etkisiz ya da ya rarl m utayonlar olsa da, byk ounluunun zararl olduunu syle yebiliriz. (ekil 23) G en e tik rekom binasyon: M utasyonlar gibi

lirli bireyleri ldrse, poplasyondaki gen frekansnda da farkllama olacaktr. Kahverengi ve yeil gzl bireylerden oluan poplasyonda ans eseri yeil gzl bireylerin ou reme ans bulamadan lrse, poplasyon ierisindeki kahverengi gz frekans daha yksek olacaktr. Bu yzden yeni doan nesillerde de kahverengi gzn bulunm a ih ti mali yksek olacaktr. Genetik srklenm e temel olarak genetik farkllkta bir azalmaya neden olacaktr. P o p la sy o n d a k i e itlili i e tk ile y e n te m e l m e k a n iz m a la r Doal seilim : Evrim in en temel m ekanizm alarndan birisi olan doal seilim , Charles Darwin tarafndan ne srlen evrim fikrinin itici gcdr. Ksaca yle anlatlabilir: Bir poplasyon ierisinde bulunan bireyler birbirin den farkldr. Bu farkllklar baz evresel artlarda birey lerin bazlarnn dierlerine oranla daha avantajl olmasna yol aacaktr. Daha avantajl zelliklere sahip bireyler daha fazla reyerek daha fazla soy verme ansn yakalayacaktr. reme ansn daha fazla elde eden bireyler de genlerini yeni nesillere aktarabilecektir. Nesiller boyunca benzer se iciliin devam etmesiyle poplasyonda belirli zellikler silinerek, seilen zellikler baskn hale gelecektir. Doal seilim yoluyla seilen bireyler evreye uyum (adaptasyon) salayacaktr. Biyologlara gre evreye en iyi uyum salayan bireyler, verim li yavrular vererek soyunun devamn salayabilen bireylerdir. Poplasyon ierisinde soyunu devam ettirebilen bireylerin genetik zellikleri de zaman ierisinde daha baskn hale gelecektir. evreye en iyi uyum salayan birey en gl, en hzl ya da en byk olan deildir. Yaamn srdrebilen, kendine bir e bulabilen ve yavrular vererek soyunu srdrebilen bireyler evreye en iyi uyum salayanlardr. (ekil 24) C in sel seilim : C insel seilim , bireyin kendine e bu labilm e ansn arttran ve sonu olarak da yeni yavrular yaparak genlerini aktarabilm esini salayan seilim m eka nizmasdr. Doal seilim in zel bir ekli olarak da d nebiliriz.

eitlilii arttran bir dier etm en ise mayoz blnm e s rasnda meydana gelen hom olog krom ozom larn para deitirm esidir. G enetik rekom binasyon ad verilen bu ilem ile m utasyonda meydana gelenden ok daha byk lekte DNA dizisi yer deitirir. R ekom binasyon ile ge n in i yaps deitirilm ez, ancak genlerin yerlerinin de im esi salanr ve hangi yavruya gidecei belirlenir. G ler: G enel olarak poplasyonlar kapal sistem ler de ildir. evredeki dier poplasyonlarla etkileim halinde dirler; poplasyon ierisinden baz bireyler poplasyonu terk ederek baka poplasyonlara katlabilir ya da kendi gruplarn kurabilir. Poplasyondan ayrlan ya da poplasyona katlan her birey ile poplasyon ierisind eki gen frekansnda ve eitlilikte
ekil 2 3 . D N A'daki tek bir
L o s y o n bu kedinin kulaklarnn hafif de olsa geriye kvrlm asnn nedenidir. ,. A b lr . y a a n a c a k t r ,

G enetik Srklenm e. Bir poplasyon ierisindeki bi reylerin ans eseri de olsa reyememesi ve yeni nesiller oluturamamaspoplasyondaki gen frekansnda dei iklie neden olacaktr. Basit bir rnek vermek gerekirse, bir yolun kenarnda bulu nan bcek poplasyonunun zerinden ans eseri bir ara gese ve poplasyondaki be

52

50 SORUDA YAAMIN TARH

EVRM

53

daha fazla tr birbirlerinin evrim lem esini etkileyebilir. rnein bir bitkinin m orfolojisinde meydana gelen bir deiiklik, bu bitki ile beslenen bir hayvann m orfoloji sinde deiiklie neden olabilir. Hayvandaki m orfoloji de iiklii de bitkide yeni bir deiiklie neden olabilir.
ekil 24. spinoz kular (Darwin'in G alapagos A dalar'nd a gzlemledii
gibi) farkl evre koullarnda farkl gaga yaplar gelitirmitir. Soldaki kakts avcsdr, uzun ve keskin bir gagas bulunur. O rta d a ki tohum avcsdr, geni b ir gagas bulunur. Sadaki ise bcek avcsdr; da r ve sivri bir gagas bulunur.

Trlerin birbirleri arasnda bulunan av/avc, parazit/ konak, rekabet ya da ortak faydaya dayal etkileim ler b ir likte evrim lem enin tem elini oluturur. (ekil 26)

C insel seilim bireyin e bulabilm e ansm arttrr ken, ounlukla yaam n srdrm e ansn drr. rnein, erkek bir kuun abartl boyutlarda ya da rengrenk olan kuyruu dii bireyleri etkilem esini salarken, avclar tarafn
ekil 25. Erkek W hydah ispinoz
kuunun (dul kadn kuu olarak da bilinir) diileri etkilemesine yarayan uzun kuyruu, avclar tarafndan da kolayca fark edilmesine neden olabilir.

-1 I Evrim kuramyla ilgili yanl bilinen I I noktalar nelerdir?

Evrim kuram bilim dnyasnn en temel kuram larn dan birisi olduu halde, birok kii evrim kuram h ak knda yanl fikirlere sahiptir. Bu yanl bilgiler nedeniyle de kiiler kuram hakknda nyargya sahip olabilir. imdi evrim hakknda genel olarak hatal bilinen nem li n okta larn zerinden geelim: 1) T eo rin in tanm : Evrim kuram /teorisi teorid ir ve b ir olgudur. Evrim kuram hakknda yeterince bilgisi olm ayanlar ya da bilinli olarak karsnda yer alanlar basit bir hataya dm ektedir. Evrim teorisi sadece bir teorid ir eklinde bir fikri savunurlar. A ncak bilim insanlar evrim kuram n anlatrken u cm leyi kullanm ay tercih eder: Evrim ku ram bir teoridir ve ayn zamanda da bir olgudur. Aradaki farklln nedeni, teori kelim esinin gnlk kullanm ile bilim alanndaki kullanm nn birbirinden baka anlam lar ierm esidir. Trk Dil Kurum unun Byk T rke S zl k ne bak tmzda bu ayrm grebiliriz. Szlkte kuram szc yle aklanyor: 1. Uygulamalardan bamsz olarak ele alm an soyut bilgi. 2. Belirli bir konudaki dncelerin, grlerin btn.

dan da kolayca fark edil m esine neden olacaktr. (ekil 25) B irlik te evrim lem e (co-evolu tion): ki ya da

ekil 26. Fotorafta grlen orkide iei ve iein yapsna uygun bir
yap gelitiren orkide ars, birlikte evrimlemeye gzel bir rnektir.

54

50 SORUDA YAAMIN TARH

EVRM

55

3. Sistem li bir biim de dzenlenm i b iro k olay ak layan ve bir bilim e temel olan kurallar, yasalar btn, nazariye, teo ri. zellikle ilk aklam ada yer alan soyut bilg i ek lin deki ifadeler, kuram kelim esinin gnl k farkl k u lla n llarnda anlam kazanr. A ncak, bilim de kuram (teo ri), bilim sel deneylerle s rek li olarak desteklenen bir h ip o tezdir. D eneylerle desteklendii s rece g len ecektir. Evrim teorisi de b in lerce kantla desteklenen, bilim dn yasnn en geerli teorilerind en birisidir. H cre teorisi (can llar hcrelerden olum utur) ya da atom teorisi (m addenin yapta atom dur) ne kadar doruysa, evrim teorisi de o derece doru b ir teoridir. Aralarnda Ernst Mayr, Douglas Futuym a, Richard Dawkins, K enneth M iller ve Stephen Ja y G ouldun da bulunduu b iro k bilim insan durumu u ekilde zet lem ektedir: Evrim in kendisi bir olgudur. Yani bir gerek olarak karm zdadr. T eori ksm ise daha ok evrim in ar kasndaki itici g olan m ekanizm alardr. rnein doal seilim gibi. ne srlen m ekanizm alaryla birlikte evrim kuram , saysz snam adan baaryla km tr ve en geer li teorilerden biri olarak karmzdadr. 2 ) Evrim kuram yaam n n asl balad zerin e de il, n asl eitlend i i zerinedir. Evrim kuram dnyada canlln ilk defa nasl ortaya ktn deil, nasl eitlendiini, yeni trlerin nasl t rediini anlatr. Dnya zerinde canlln ilk defa nasl ortaya ktn, inorganik m addelerden kendini kopyala yabilen ve canlln tem elini oluturan m olekllerin nasl olutuunu anlatan bilim alanna abiogenesis ya da kim yasal evrim ad verilir. Bu ksm daha sonraki blm lerde daha detayl anlatlacaktr. 3 ) n san m aym unlardan gelm ez, insan ve m aym unlar o rtak ataya sahip tir. Evrim kartlarnn srekli olarak vurguladklar yanl bir fikir, evrim kuram nn insanlarn maymunlardan geldi ini nerdii fikridir. Yetersiz ya da yanl bilgilendirme so nucu oluan bu fikir yznden, ou kii evrim kuramna

kar bir nyargya sahiptir. An cak evrim kuram insann may mundan geldiini ne srmez; in san ile maymunun ortak bir ataya sahip olduunu ne srer. Benzer ekilde, zamanda daha gerilere gidildiinde dier organizmalarla da ortak ataya sahip olunacaktr. Maymunlar dier canllara oranla bize daha yakn akrabadr. Maymunlarla insanlar ara ekil 2 7 . A rd i'n in dii sndaki en son ortak ata ile ilgili bireyine ait d grn srekli yeni bulgular ortaya ka canlandrm as. rlmaktadr. A rdipithecus ram idus ad verilen ve insan ile Afrikal byk kuyruksuz maym un lar arasndaki bilinen son ortak ata olduu kabul edilen trn kefiyile ilgili almalar, Science bilim dergisinin 2 Ekim 2 0 0 9 saysnda 11 makale ile aktarlm tr. (ekil 27, ekil 28) insann evrimi konusunda son yllarda yaplan en nem li almalardan olan aratrmada, 4 ,4 milyon yl nce (my) yaad tahm in edilen trn yaad habitat ve insan ve empanzeler arasndaki benzerlik ve farkllklar
ekil 28. insann evrim ini ve maymun trleriyle olan yaknln gsteren
diyagram . ekildeki num aralar farkl trleri ve ortak atalar ifade ediyor. 1) femel dm , 18 milyon yl nce yaam olan ve kuyruksuz byk m oym unlarn potansiyel atas. 2) O ra ngu tan klad. 3) Yaayan kuyruksuz byk maymunlar, insan, empanze ve goril ile paylalan ortak ata. 4) G orillere giden evrimsel izgi. 5) empanze ve bonoboya giden ayrm. 6) G e Miyosen Dnem hom inid klad ayrm. 7) O rta Pliyosen Dnem hom inid klad ayrm ve 8) Pliyo-pleistosen Dnem hom inid kladna giden ayrm. Ardi 6 -7 arasnda ve modern insan da 8 'in sonunda grlebilir.

0 0
O

1 ^
Pon paniscus

+ il
Pon troglodytes Gorilla gorilla

t
Pongo pygmoeus

}
Homo sapiens

^
Australopithecus Ardipithecus aforensis* ramidus*

56

50 SORUDA YAAMIN TARH

EV R M 5 7

vurgulanmtr. Bu al m ann bizim iin nemli yanlarndan birisi, ara trma grubu ierisinde 3 Trk bilim insannn da bulunmasdr. (Prof. Dr. Erksin Gle, Dr. Cesur
ekil 29. Insan en mkemmel ya da en

7) Evrim kuram sadece b irk a k iin in kabul ettii b ir kuram deil, b ilim in san larn n o rtak olarak kabul ettii o k genel b ir kuram dr. Yaygn olan bir dier yanl fikir ise evrim kuram nn sadece kk bir ksm bilim insan arasnda kabul gr d ve bilim cilerin evrim in olup olmad konusunda birbirleriyle tartma halinde olduklardr. Bu son derece yanl bir fikirdir. Dnya zerinde canllarn eitlenm esini aklayan bi lim sel fikrin evrim kuram olduunu aklayan bilim ens titlerinin listelerine gz atabiliriz. Burada dikkat edilm e si gereken nokta, verilen listelerde evrim i kabul edenlerin her birinin birer bilim enstits olm asdr. Yaplan bild iri ler her bir enstitde alan binlerce bilim insannn ortak fikridir. Bu listelere ek olarak, internette ufak bir arama yaplarak evrim kuram n kabul eden binlerce bilim insa nnn (N obel dll aratrm aclar dahil) isim lerine ula m ak m m kndr. TBA (Trkiye Bilim ler Akadem isi) ve TBTAK, l kem izin en nde gelen bilim kurulularnn banda yer alrlar. 1998 ylnda yaym ladklar ortak bildiriyle evrim kuram nn yaamla ilgili en tem el kuram lardan birisi ol duunu kabul ettiklerini aklam lardr. Dier bir liste ise, dnya apnda tannm bilim sel enstitlerin oluturduklar Interakadem i Panel isim li g nll kuruluun listesidir. Bu kurulu belirli dnem ler e k i l 3 0 . G ri balinalarn atas, karada yaayan memeli Pakicetus ve ara form Aetiocetus. Aetiocetus saysz ara form dan biridir.
Burun de lii kafatasnn n ksmnda Burun delii kafatasnn orta ksm nda Burun delii kafatasnn st ksmnda

Pehlevan ve Dr. Ferhat Kaya) ileri tr deildir. C a n lla r b ir merdiven Daha sonraki sorular gibi yukarya do ru deil, bir aacn da insan evrim ini daha dallar gibi eitlenmitir. detayl inceleyeceiz. 4 ) tn san en g elim i ya da en ileri form deildir. T r lerin birb irin d en ayrm n b ir m erdiven olarak deil, b ir aacn d allan olarak kabul etm eliyiz. Evrim kuram canllar bir basam ak eklinde basitten m kem m ele sralamaz. Bunun yerine bir aacn dalla r eklinde gruplama yapar. Birbirine daha yakn akraba olan trler daha yakn dallarda bulunur. Her tr bulundu u ortam n gereklerine gre ekillenir. (ekil 29) 5) Evrim rasgele/tesadfi alm az. Gnm zde yaayan canllar im diki hallerine m il yonlarca yl sren evrim sel deiim sonunda varm lar dr. A ncak bu gelim e tesadfi bir gelime deildir. Evrim tesadflerle almaz. Poplasyonun bireylerinin birbirle rinden farkl olm asn salayan tem el etken olan mutasyonlar tesadfi olabilir, ancak daha sonra avantaj yaratan zelliklerin seim i tesadfi deildir. Seilim , poplasyonda meydana gelen m utasyonlar zerine tesadf olmayan bir yolla alr, sreklilii ve rem eyi salayan zellikler seilir ve poplasyonda daha yaygn zellik halini alr. Bu yzden de evrim tesadfi deildir. 6 ) Saysz araform bu lu nm utur. Bir dier yanl bilgi ise trlerin nceki trlerden evrim letiini gsteren araform larm olmaddr. nternette ksa b ir aratrmayla, bulunan saysz araform rneinin bilgisine ulalabilir. Balinann evrimi nem li rneklerden birisidir. (ekil 30)

Pakicetus

A etiocetus

Gri balina

50 m ilyon yl nce____________2 5 m ilyon yl nce______________ Bugn

58

50 SORUDA YAAMIN TARH

EVRM

59

de yaymlad bildirilerle k ritik konularda toplum a ve yneticilere danm anlk yapmay am alar. 2 0 0 6 ylnda yaymlanan bildiride, evrim kuram nn doruluu ve ev rim i retm enin nem i vurgulanm tr. Bildiride; Bugn evrenin, yeryznn ve canllarn ortaya k ve geliim i hakkndaki bilim sel deliller, dnyann birok lkesinde gizlenm ekte, arptlm akta veya bilim in smayamayaca teorilerle kartrlm aktadr aklam as da bulunm ak tadr. Bildiriye imza koyanlarn binlerce bilim insann tem sil eden bilim sel enstitler olduu unutulm am aldr. (ekil 31 ) Evrim in geerliliini gsteren dier bir kaynak ise 16 ubat 2 0 0 9 tarihli N ature dergisinde 2 0 0 9 Darwin Y l nedeniyle yaym lanan makaledir. nternette arama m otor lar yardmyla anahtar kelim e kullanlarak bilim sel al m alar arasnda bir tarama yaplm ve sonular da m aka lede yaym lanm tr. 2 0 0 8 tarihine kadar dnya apnda yaplan bilim sel m akaleler ierisinde natural selectionekil 31. interakadem i Panel'in 2006 ylnda yaym lad, evrim kuram nn
do ruluunu ve evrimi retm enin nem ini vurgulayan bildiriye imzasn koyan 6 8 bilimsel enstitden bir blm nn listesi.

ekil 32. "N atu ral selection" anahtar kelimesiyle yaplan aram ada elde edilen bilimsel m akalelerin konulara gre dalm .

doal seilim eklinde arama yapldnda elde edilen alm a says 1 4 .2 3 2 dir. Bunun anlam , bu sayda farkl bilim sel alm ada, verilen anahtar kelim eler kullanlm tr. Evrim ya da evrim kuram ile ilgili dier anahtar kelim elerin kullanlm as ile elde edilen makale says ok daha fazla olacaktr. ekil 3 2 de elde edilen 1 4 .2 3 2 bilim sel m akalenin hangi alma alanlarnda olduu da gste rilm ektedir. Bu kantlar evrim kuram nn bilim insanlar tarafndan kabul edilm eyen bir kuram olduu ynndeki fikirleri yalanlam aktadr. Burada verdiimiz rnekler, evrim kuram nn bilim lemi tarafndan kabuln gsteren rneklerden sadece birka tanesidir. EFfak b ir aratrm ayla bu rnekler oal tlabilir. nem li olan, bu kitabn da konusu olan, can ll n m ilyarlarca y llk geliim inde tem el belirleyici etm e nin evrim olduunun n et ekilde anlalm asdr.

Gedmekte Olan lkeler Bilimler Akpdemisy ' l l B a s Bilim onsep Tovvan Bilimler Akademisi

60

50 SORUDA YAAMIN TARH

EVRM

61

H I Evrimin I Im I kantlan nelerdir?


C anllarn evrim leerek eitlendiinin k an tlan ok farkl bilim dallarndan gelir. Ayn zamanda, antropolo ji , astrofizik, kimya, je o lo ji, fizik, m atem atik, davran ve sosyal bilim ler gibi bilim disiplinlerinde gerekletirilen gem i ve m odern zaman aratrm alar, evrim iin k an t lar salar. Astrofizik ve je o lo ji, Dnyanm yann evrim yoluyla bugnk trlerin olum asna yetecek derecede yal olduunu gsterm itir. Fizik ve kimya, nem li ev rim sel olaylarn zam anlam asn olanakl klan tarihlem e m etotlarnn gelitirilm esini salamtr. Dier trlerin allm as, trler arasnda sadece fiziksel devamlln de il, ayn zamanda davransal devamlln da olduunu gsterm itir. A ntropoloji hem insann kkeni ve hem de biyolojiyle kltrel faktrler arasndaki etkileim ler ze rine yeni bak alar getirm itir. Radyom etrik tarihlem e: Bilim insanlarnn evrim a lmalarnda kullandklar en temel yollardan biri radyo metrik tarihleme yntemleridir. Bu yntemler sayesinde, tarihncesinden kalm kayalarn, fosil rneklerinin, in san yapm aletlerin vb. ya hesaplanabilir. Yntem lerin temeli ksaca yledir: Baz atomlar radyoaktiftir. Bunun anlam, bu atomlar doal olarak dier radyoaktif ve radyo aktif olmayan atomlara bozunur ve bu srada da atom alt partikller ve enerji yayarlar. Her radyoaktif atom kendine zg yan mre sahiptir. Yar mr bir rnekteki atomla rn yarsnn bozunmas iin geen sre demektir. Radyo aktif atomlar bu yzden materyallerin bir i saati gibidir. Bir materyaldeki radyoaktif elem entin m iktarnn mater yalin bozunmu ksmyla karlatrlmas yoluyla, mater yalin ne zaman olutuuna karar verilebilir. Bu lmlerle Dnyanm, Ayn, m eteoritlerin ve Gne Sistem inin ya hesaplanmtr. Tm bu lm ler bu gkcisim lerinin m il yarlarca yl yanda olduunu gstermitir. Benzer ekilde fosiller ve bulunduklar toprak katm anlarnn ya hesap

lanarak, canlnn ne zaman yaad bulunabilir. Fosil kaynaklar: Canl larn evrimini gsteren bir dier nemli kaynak da elde edilen saysz fosil rneidir. Fosil rnekleri, canllarn za man ierisinde gsterdikleri deiimi ortaya koymaktadr. rnein, uzun sredir gn demde olan A rchaeopteryx fosili, dinozorlar ile kular

ekil 3 3 . in'de kefedilen ve 2 0 0 6 ylnda rapor edilen kubenzeri gei fosilinin neredeyse btn haldeki iskeleti.

arasndaki geii gsteren ok bilinen bir fosil rneidir. A rchaeopteryx bir dinozorun iskelet yapsna ve ayn zaman da da ty ve kanatlara sahip 155 m ilyon yllk bir fosildir. inde bulunan 110 m ilyon yllk ku benzeri fosil rnek lerinde de ufak kuyruk ve pene uzantlan bulunmutur. (ekil 33) Daha yakn zamanlara ait fosil rneklerinde de balina, fil, armadillo, at ve insan gibi birok modern orga nizmaya giden evrimsel yollar ortaya karlmtr. O rtak yap ve davranlar: Eer iki trn ortak atalar grece olarak daha yakn bir zamanda yaam ise, bu iki trn sahip olaca ortak fiziksel zellikler ve davran lar, ortak atalar daha eski zamanda yaam olan trlere gre daha fazla olacaktr. Bu yzden de insanlar em pan zelere, balklara benzediklerinden o k daha fazla benzer. Bununla birlikte, tm organizm alar baz ortak zellikleri paylar, bunun nedeni her organizm ann gem ite bir noktada ortak bir ataya sahip olm asdr. rnein, biriken fosil ve m olekler kantlara dayanarak, insanlarn, in ekle rin, balinalarn ve yarasalarn ortak atasnn yaklak 100 my (m ilyon yl nce) yaad tahm in edilen, kk bir m em eli olduunu syleyebiliriz. O ortak atann soyundan gelen nesiller tem el deiiklikler geirdilerse de, iskelet yaplar dikkat ekici bir ekilde benzer kalm tr. K em ik lerden oluan ve detaylar farkl olsa da genel yaps ve birbirine ilikileri benzer olan iskelet yaps ile insan ya zar, inek yrr, balina yzer ve yarasa da uar.

62

50 SORUDA YAAMIN TARH

EVRM

63

nsan

Kpek

Balina

Ku

K o l k e m i i

(H um erus)
n k o l k e m i i ( H um erus) v D ir s e k k e m i i \

yapmalarna olanak salar: Fiziksel ve davransal benzer likler, ortak atadan gelen bir sonu mudur; yoksa benzer evrimsel meydan okum alara kar gelitirilm i bamsz cevaplar m dr... M olek ler b iy o lo ji kantlar: DNA bir nesilden dieri ne, atadan (ebeveyn hcreden) dorudan yavruya (yeni hcreye) geerek (eeysiz remede olduu gibi) ya da D NA-ieren sperm ve yum urta h crelerinin birlem esi yoluyla (eeyli oalan organizm alar gibi) aktarlr. Daha nce de tartld gibi, DNA nkleotidlerinin dizisi bir nesilden dierine m utasyonlar yoluyla deiebilir. Eer bu deiiklikler organizmaya yararl zellikler kazandryorsa, yeni DNA dizisi yksek ihtim alle poplasyo ieri sinde nesiller boyunca yaylacaktr. Ayn zamanda, orga nizm ann sahip olduu zellikler zerinde etkisi olmayan ntr m utasyonlar da DNA nesilden nesile geerken poplasyon ierisinde korunabilir. Sonu olarak DNA, ge m iteki evrim sel adaptasyonlardan sorum lu deiiklikler gibi, genetik deiikliklerin bir kaydn ierir. Benzer ola rak organizm ann sahip olduu proteinler de, m etabolik yol izleri de, zaman ierisinde evrim leerek eitlenm itir. DNA dizileri arasndaki benzerlik, dier biyolojik m ole kllerde de aranabilir. (ekil 36) Biyologlar iki organizm ann DNA dizilerini karlat rarak, o organizm alarn ortak atay paylatklar zam an dan beri ne tr genetik deiiklikler geirdiklerini ortaya karabilir. Eer iki tr grece olarak daha yakn zamanekil 35. Yunuslarn (solda) insanlarla olan akrabal, kpekbalklarna
(sada) olan akrabalklarndan daha yakndr; buna ramen yun uslarda kpekbalklar da su ortam na adapte olmu vcut yaplar gelitirmitir. Bu analog yaplara bir rnektir.

1
(U lna) j

f
El p a r m a k k e m ik le r i

E l b i l e il c e m ik l e r i

(C arpals)
ta ra d k e m ik le r i

(M e ia c a tp a k l
'

/P h a la n g es)

ekil 34. Karasal ve suda yaayan baz om urgal hayvanlarn


n bacaklarndaki kem ikler dikkat ekecek derecede benzerdir, nk hepsi ortak bir atann n bacaklarndan evrimlemitir. Bu hom olog (trde) yaplara bir rnektir.

Evrim biyologlar ortak atadan treyen benzerliklere hom oloji (trdelik) adn verm ektedir. Karlatrm al anatom istler bu tr h om olojileri sadece kem ik yapsn da deil, vcudun dier tm paralarnda da aratrr ve benzerlik derecesinden evrim sel ilikileri karrlar. Dier biyologlar da ayn m ant kullanarak, deiik organlarn fonksiyonlarndaki, em briyolarn geliim lerindeki ya da deiik organizm alarn gsterdikleri davranlardaki ben zerlikleri aratrr. Bu aratrm alar bugnn organizm a lar ile ortak atalarnn balarn gsteren kantlar salar. Bu kantlar zerine kurulan hipotezler de fosil kaytlar incelenerek test edilebilir. (ekil 34) Bazen, ayr soylar birbirinden bam sz olarak benzer yaplara evrim leebilir. Bu tr yaplara analog yaplar ad verilir. H om olojilere benzerler, ancak ortak atadan deil ortak evreden ileri gelirler. rnein, yunuslar kara m em elilerinden 50 m ilyon yl kadar nce evrim leen de niz m em elileridir. Evrim sel terim lerle yunuslarn balkla ra uzakl, fareler y a'd a insanlarn balklara uzaklyla ayndr. Ancak yunuslar, balklarn, kpekbalklarnn, hatta soyu tkenm i Ichthyosauru s denilen dinozorlarn vcutlarna benzer aerodinam ik vcut yaplan evrim letirm ilerdir. (ekil 3 5 ) B iy olojin in birok deiik alann dan gelen bu tr kantlar, evrim sel biyologlarn u ayrm

64

50 SORUDA YAAMIN TARH

EVRM

65

em panze | l | | H oran gutan babun m arm o set # 1 le m u r fare ta vu k balo n bo lk

I I |I p ^ l( B

il ( ll^ im

'- )

Yol 0 0 'insan n kle o tid d izile ri ile % 5 0 benz erlik derecesi

goril | insan g t g c c c a t c c a a a a a g t c c a | G a t g a c a c c a a a a c c c t c a t c a a g a c a a t t g t c a c c a g g

llp llii

empanze g t g c c c a t c c a a a a a g t c c a | g a t g a c a c c a a a a c c c t c a t c a a g a c a a t t g c a c c a g g

mmmmtm imin m m mm m

insan ATMTGAATTTCAAACGCAGTCAGTCTCCTCCAAACAGAAAGTCACCGGTTTGGAC
...

t
, 1 0 0 n k le o tid cifti 1 0 .0 0 0 n kle o tid cifti ,

empanze ATCAATGACATnCACACACGCAGTCAGTCTCCT^CAAcAGAAilTCACCcTTTGGAC goril C goril insan TTCATTCCTGGGCTCCACCCTCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC


l i l l l l I I I l i l l i l II l I I I I I I I I I I I I I I I I I I l i l I I I ! I I I ! I I I I I I I I

e k i l 3 6 . insanlarda mutasyona uradnda kistik fibroza neden olan


gen, empanzelerdeki karlk gene olduka benzerdir; fakat insanlarla daha uzak akraba olan organizm alardaki karlk gelen genlere daha az benzerdir. Yeil ubuklarn ykseklii baka organizm alardaki genin, 1 0 .0 0 0 nkleotid aralnda, insan genine olan benzerliini gstermektedir.

empanze t t c a t t c c t g g g c t c c a c c < # a t c c t g a c c t t a t c c a a g a t g g a c c a g a c a c t g g c a g t c

larda bir ortak ataya sahipseler, eski zam anlardaki bir ortak ataya sahip olan trlere oranla DNA dizileri daha benzer olacaktr. rnein, insann DNA dizisi empanze DNAsm dan ortalam a olarak sadece yzde birka farkllk gsterir. Bu derece benzerlik em panzelerle grece olarak yakn zamanlarda ortak bir ataya sahip olduumuz anla m na gelir. A ncak insan DNA dizisi babun, fare, tavuk ve kirpibalklarm m DNAlar ile karlatrldnda, farkl ln giderek artt gzlem lenir. Artan farkllk, o orga nizm a ile olan evrimsel yaknlm zn azalm as anlam na gelir. nsan DNA dizisini sinek, solucan ve bitk i DNAlar ile karlatrdm zda, farklln daha da fazla olduu bulunm utur. O rtak ata zerinden ne kadar zaman ge mi olursa olsun, her tr yaam form unun DNA dizileri arasnda benzerlik grlebilir. Hatta insan ve bakteri DNA dizilerindeki belirli baz genler arasnda benzerlik grl m ektedir. Bu benzerliklerin anlam her iki organizmada da benzer fonksiyonlara sahip m olekler sistem lerin var ldr. Bylece, biyolojik evrim, insan yaam iin nem li olan biyolojik srelerin anlalm as iin neden dier o r ganizmalar zerine de allm as gerektiini gsterm ek tedir. G erekten de, bugn gerekletirilen biyom edikal aratrm alarnn ou, yaayan tm canllarn sahip o l duklar biyolojik ortaklklara dayanmaktadr. (ekil 37)

empanze t a c c a a c a g a t c c t c a c c a g t a t g c c t t c c a g a a a c a t g a t c c a a a t a t c c a a c g a c c t g goril
a

___ _ m m m m m

insan t a c c a a c a g a t c c c a c c a g t a t g c c t t c c a g a a a c g t g a t c c a a a t a t c c a a c g a c c t g

insan GAGAACCTCCGGGAtmmCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG empanze GAGAACCTCCGGGACCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG goril


e k i l 3 7 . Insan ve empanzede leptin horm onunu (ya m etabolizmasnda yer alan) kodlayan genlerin D N A dizileri karlatrldnda, 2 5 0 nkleod iinden sadece be nkleotidin farkl olduu ortaya karlmtr, insan ve empanze dizilerinin fa rkllk gsterdii yerde, gorilde karlk gelen nkleotid kullanlarak (glgeli izgiler), insan, empanze ve gorillerin ortak atasnda m uhtem elen var olan nkleotid bulunabilir. Her iki durum da, goril ve insan nkleotidleri eleirken, dier durum da goril ve empanze dizileri ayndr. G o ril, empanze ve insann ortak atasnn, gnm z organizm alarnn te ikisinde ayn olan nkleotide sahip olmas muhtemeldir, nk bu durum ikiden ziyade tek bir D N A deiikliine ihtiya duyacaktr.

mimimin mmmmmmmmmmm

SU

ve

DNYA DII YAAM

67

5.

Blm

SU ve DNYA DII YASAM

" i *3 I Suyun yaam iin I 3 I nemi nedir?


En k k m ikroplardan en byk hayvanlara, dnya zerindeki tm canllarn yaamlar suya baldr. Sahip olduu ok farkl zellikler sayesinde, Dnya yzeyinin ve atm osferinin ekillenm esini salam, yaam n ortaya kp gelim esinde ve devamllnda vazgeilm ez bir rol oynam tr. Dnya yzeyinin yzde 7 1 i su ile kapldr; bunun da yzde 9 7 sini okyanuslar ve geri kalann ise buzullar, kutup bu zlan, gller, nehirler vb. oluturur. Suyun, yaam n ortaya k ve devamll asndan son derece vazgeilmez yapan zelliklerini yle sralaya biliriz: 1) Su, iki hid rojen ve bir oksijen atom unun kovalent balarla balanm as ile oluur (H20 ) . O ksijen atomu az da olsa negatif ykldr, hidrojen atom lar da pozitif ykl dr. H idrojen ve oksijen atom lar arasndaki ba dorusal deildir. Bu yapnn sonucunda da su m olekl yk ola rak kutupsal bir yapdadr. Bir tarafta pozitif, dier taraf ta negatif yk bulunur denebilir. O luan bu kutupsallk,

68

50 SORUDA YAAMIN TARH SU ve DNYA DII YAAM

69

suyun sahip olduu o k nem li zelliklerin tem elini oluturur. (ekil 38) Suyun kendi iinde, m olek l ler aras etkileim leri ve temasta olduu dier maddelerle etkile im leri vardr. Kendi m oleklleri ekil 38. N ega tif ykl arasndaki etkileim ler sayesinde oksijen atom u ve pozitif ykl su yzeyinde yksek bir yzey hidrojen atom u sayesinde su gerilim i oluur. Bunun tem elin kutupsal bir yapdadr. de m olekller aras oluturduu hidrojen balar vardr. Benzer hid rojen balarn birok farkl m oleklle de yapma eilim indedir ve dier m ater yallere yapm asn salayan ve adhezyon ad verilen bir zellik de bu yolla ortaya kar. Dier m olekllere olan balanm a isteinin kendi m oleklleri arasndaki etkile im lerden daha fazla olmasyla kapiler etk i ad verilen ve suyun tpler ierisinde kendiliinden yukar doru km asn salayan bir etki oluur. zellikle yksek aa lar topraktan aldklar suyu st ksm larna kadar suyun bu zellii sayesinde karr. rnein, servi aac uzun bir aatr ve yerden 3 0 m yukarlara suyu karm ak iin k ul land nem li etkenlerden birisi, suyun kapiler hareket zelliidir. ok daha ksa birok bitk i de, suyun bu zelli ini kullanarak suyu yukarlara doru tarlar. (ekil 3 9 ) 2) Su kat hale getiinde (donduunda) younluu azalr. Bu sayede kat haldeki buz, sv suda batm az. Bu zun su yzeyinde y ekil 39. Kapiler etki sayesinde, zyor olm as yaamn servi aac gibi uzun aalarda su evrim i asndan ok en tepelere kadar tanabilir. nem lidir. Eer buz sudan daha youn olsayd, Dnya sou duka okyanuslarda oluan buz dibe ba tacak ve alttaki souk suyu yukar itecekti. Yukarda souk su

donduunda tekrar b a tacakt. Bu durum, tm su donana kadar devam edecekti. B irok deniz ve gl de bu ekilde buz ile dolacakt. Bu da su iin de olan yaam n byk ekil 40. Devasa boyutlardaki buzullar, olaslkla sonu olacakt. sv suyun daha youn olmas sayesinde zellikle ilk yaamn yzeyde kalrlar. sularda ortaya kt dnlrse, yaamn evrilmesi de engellenm i olacakt. (ekil 40) 3) Suyun dier bir zellii de donduunda genlemesidir. Bu zellik karalarn ekillenmesi asndan olduka nem lidir. Kayalarda bulunan atlaklardan ieri szan su, geceleri scaklk dtnde donar ve genlemeye balar. Gndz olduunda ise hava snr ve atlakta bulunan su daha de rine doru ilerler. Gece tekrar donar. Kayalarn bu yolla paralanmas, toprak olumasna neden olur. Bitkilerin ok byk bir ksm toprak zerinde gelimitir. (ekil 41) 4 ) Is kapasitesi en yksek ik in ci m olekl sudur (am on yaktan sonra). Bu zellik, suyun karbondioksit ile birlikte Dnya atm osferindeki s dalgalanm alarn tam ponlam asn (dengelem esini) salar. Bu sayede, atm osferde anlk ar scaklk art ya da d yaanm amaktadr. 5) Su saydamdr. G elen gne suyun ierisine gi rer. Suda yaayan ve fotosentez yapan canllarn gelim esi ve yaam larn srdrebilm esi iin gne vazgeil mezdir. (ekil 42) ekil 4 1 . Kayalar arasna giren 6) Fotosentez yapan suyun donarak genlemesi, bitkilerin geliebilecei top ra n oluum una yol canllar gne en erji amtr. sini kullanarak suyu oksijen ve hidrojene paralarlar. Hidrojen dardan alm an C 0 2 ile birleerek glikoz yapm nda k u llan lr ken oksijen ise dar

70

50 SORUDA YAAMIN TARH

SU v e DNYA DII YAAM

71

ya verilir. O ksijenli solu num yapan organizmalar da bu ilem i tersine evi rerek oksijeni kullanr ve glikozu paralayarak tek rar suyu ve C 0 2yi olutu rurlar. 7) olarak adlandrlr. Tuzlar, ekerler, asit, bazlar ve ok sijen ve karbondioksit gibi su-seven gazlar suda znrler. Yaam n tem elini olu turan protein, DNA ve polisakkarit gibi hcrenin parala r da suda znr. Vcutta gerekleen birok m etabolik aktivite su ierisinde gerekleecektir. nsan vcudunun yzde 6 0 -7 0 i sudan oluur. Benzer ekilde bitkilerde bu
ekil 4 2 . Su zararl UV nlarn engellerken, fotosentez iin gerekli n girmesine izin verir.

oran yzde 9 0 a kadar ve baz hayvanlarda da (rnein denizanas) yzde 9 4 -9 8 e kadar kabilir. Tm bu zellikler, suyun yaam n ortaya k ve de vam etm esinde ne derece belirleyici olduunu ortaya k o yuyor. Tm bu zellikler yznden de, Dnya d yaam aratrm alarnda ilk baklan yerler suyun sv halde bulu nabilecei dnlen blgeler olm utur.

ncelikle gezegenin bulunduu yldz sistem inin ga laksi ierisindeki konum u nemlidir. rnein, Dnyamn da iinde bulunduu Gne Sistemi, Samanyolu Galaksisi ierisinde yer alr. Galaksilerde merkeze doru gidildike yldzlarn younluu (ar metallerin artmasyla beraber) artacak ve yldz evrelerinde gezegen olum as da daha yksek bir olaslk olacaktr. Yaamn dnya benzeri geze gen ya zc da uydularda ortaya kaca dnlmektedir. An Su, evrensel cak galaksi merkezine doru gidildike spernova (enerjisi biten yldzn patlamas) oluma ihtim ali de artar. Patlama annda ortaya kacak yksek radyasyon belirli uzaklktaki gezegenlerdeki oluabilecek ozon tabakasn ve olas yaam formlarn yok edecektir. Bu yzden galaksi m erkezine daha yakn, ancak spernova blgesi dnda bulunan yldz sis temlerinde yaam grnme olasl daha fazla olacaktr. Gezegenin yldz sistem i iindeki konum u da nem lidir. Yaanabilir blge (habitable zone), yldzlarn evresinde dnya benzeri karasal gezegenlerin olutuu, atm osferin gelitii ve suyun yzeyde sv halde bu lu na bildii blgelerdir. Ksacas, yaam n olum as iin gerekli artlarn olutuu blgedir. rnein, Gne Sistem indeki yaanabilir blge yaklak olarak Vens ile Mars gezegen lerinin arasndaki blgedir. Dnya da bu blgede yer alr. Vens G nee Dnyadan daha yakndr ve yzey scakl sv su bulunam ayacak kadar yksektir. Mars ise G nee Dnyadan daha uzaktr ve ar souk yzeyi nedeniyle su sv halde bulunm ayacaktr. Suyun byk ksm kutup blgelerindeki buzullarda sakldr. Yaanabilir blgenin belirlenm esinde, G neten olan uzaklk tek bana yeterli deildir. Yldzn boyutu, tipi ve ya parlakln etkileyecektir. Yldzlar yalandka daha parlak ve scak olacaklardr. Bu yzden de zaman getike yaanabilir blge yldzdan daha uzaa kayacaktr. Daha parlak bir yldzn snk bir yldza gre yaanabilir b l gesi kendinden daha uzakta olacaktr. G ezegenin boyutu da etkilidir. K k bir gezegen (r nein, M arstan kk bir gezegen) atm osferinde sv suyu tutacak kadar ktleye sahip olm ayacaktr. Sonu

Evrende yaam nerelerde ortaya kabilir? Yaanabilir blge nedir?


Bilim insanlar, evrende bulunan milyarlarca gezegenin sadece ok kk bir ksm nn yaama elverili olduunu dnyor. Yaygn olan genel gr, yaam iin gerekli tem el artlarn sv su, kullanlabilir enerji kayna (r nein, lotosentez iin gerekli olan gne ) ve organik (karbon ieren) kim yasallar olduu ynndedir. Tm bu artlarn olum asnda, gezegenin evrende bulunduu k o num u belirleyicidir.

72

50 SORUDA YAAMIN TARH

SU ve DNYA DII YAAM

73

Yaanabilir Blge

M ars D nya V ens

Dnya ise yaam n gelim esi iin uygun b ir gezegendir. G nee olan uzakl, ok scak ya da ok souk bir at m osfere sahip olm asna neden olm am tr. (ekil 4 3 ) Kta hareketleri (tekton ik hareketler) meydana gelir ve zel likle Dnyann ilk zam anlarnda yksek m iktarda C 0 2 salm m meydana gelm itir. Zamanla bu salnm azalm ve bir noktada kendi kendini kopyalayabilen canl m o lekller ortaya km tr. Atm osferde fotosentez ve solu num yapan organizmalar sayesinde C O , seviyesinde bir denge olum utur. Endstrinin gelim esi ve orm anlarn yaklm asyla birlikte, daha fazla C 0 2nin atm osfere saln m as var olan dengeyi bozmaya balam tr. Sonu olarak, artan sera etkisi nedeniyle atm osferik scaklk artacak ve dnya yzeyindeki canll tehdit eder hale gelecektir. Buraya kadar bahsedilen genel k riterler, yeni kefed i lecek gezegenlerden elde ed ilecek b ilgilere gre deie bilir. rnein, NASA tarafndan frlatlan K epler m ekii G ne Sistem i dnda 5 yeni gezegen k efetm itir. Bu gibi yeni kefed ilen gezegenlerdeki aratrm alarda sv suya rastlanrsa, yaanabilir blge tanm nda da d eiik lik ler olabilir. D ikkat edilm esi gereken dier bir etken de udur: Ge zegenlerin yzeylerinde sv su bulunm am as, yzey al tnda da bulunm ad anlam na gelmez. Yzeyin altnn da aratrlm asyla yaanabilir yeni blgelere ulalabilir. Buzla kapl bir gezegen yzeyde su bulundurm asa da, y zey altnda sv halde su bulundurabilir ve basit de olsa bir yaam ekli gelimi olabilir.

ezegea yrnge yarapma Pnyg.yrnge yarapna oran

ekil 43. Dnya, yaamn geliebilecei ve G ne'ten belirli bir mesafede


bulunan yaanabilir blgede bulunur.

olarak yzeydeki suyu kaybedecektir. Dnyadan 10-15 kat daha byk bir gezegen ise, yksek ekim gc y znden uzaydan gaz bulutlar ekerek atm osferinde tu tacaktr. A tm osferik basn sv su bulundurm ak iin ok yksek olacaktr. G ezegendeki kta hareketleri de (tektonik hareketler) atm osferdeki scakl etkiler. Sonu olarak suyun buz, sv ya da gaz halinde olm asn etkileyecektir. rnein, Mars gezegeni kta hareketleri olm ayacak kadar ufak bir gezegendir. Bu yzden volkan patlam alar grlm ez. G e zegenin ilk zamanlarnda volkanik aktivite olduu d nlse de, gnmzde atm osfere karbondioksit (C O ) sa lim im salayacak bir olay yoktur. C O ,, salntn sera etkisi yaratan ve atm osferin scakln arttran bir gazdr. O rta lama yzey scakl -6 0 C civarndadr. Bu scaklk sv halde suyun bulunm as iin o k dk bir scaklktr. V enste ise ok fazla m iktarda C 0 2 bulunur. G nee daha yakn olduundan yzey scakl Dnyadaki y zey scaklndan o k yksektir. Bu da yzeyden yksek m iktarda buharlam a olm asna neden olur. V olkanlarla atm osfere salm an C 0 2 devaml artan sera gaz etkisine yol aacaktr. Scaklk da artmaya devam edecektir. Venste ortalam a yzey scakl 4 8 2 C dir. Bu da sv su bulun mas iin ok yksek bir scaklktr.

Hj H I Dnya dnda I 3 I yaam var mdr?


Saysz bilim insan, Dnya d bir yaam n b elirtileri ni bu labilm ek iin aratrm alarna devam ediyor. ne s rlen olas yerler arasnda Vens ve M ars gezegenleri, J

74

50 SORUDA YAAMIN TARH

SU ve DNYA DII YAAM

75

piter ve Satrnn uydular (Europa, Enceladus ve Titan ) ve Gne Sistem i dndaki G liese 5 8 1 c ve d gezegenleri n celikli sradadr. Bu aratrm alar srasnda dikkat edi len en nem li k riter yaam n oluabilecei bir evrenin ve zellikle sv suyun var olabilecei bir yer b u labilm ek tir. Bunun dnda uzay boluunda ya da Dnyaya d m m eteorlar zerinde bulacam z karm ak yapdaki organik m olek ller ya da tarihncesinden kalm a hcre kalntlar da, Dnya d yaam konusunda bize fikir ve rebilir. (ekil 4 4 ) Aratrm alarn iki temel balk altnda toplandn syleyebiliriz. lki bilim insanlar tarafndan dorudan ya plan aratrm alardr. Gne Sistem i iinde ve Dnyaya den meteorlarda olas yaam izleri aratrlm aktadr.

Dorudan aratrmalar
Bu aratrmalarda NASA (Am erikan Ulusal Havaclk ve Uzay D airesi) ba ekiyor. NASA, kurulduu 1 9 5 8 den itibaren astrobiyolojinin tem el sorularna zm aramaya devam ediyor. Burada NASAnn uzay program larna bir gz atarsak, Dnya d yaam aratrm alar hakknda ye terli bir fikre sahip olabiliriz.
ekil 44. Gliese 581 yldznn yaanabilir blgesinde zellikle 581 d ve
5 8 1 c 'n in konum lar, yaamn oluabilmesi asndan nem tayor.

G ne S iste m i iin d e: Dnya d yaam ile ilgili ilk p roje Dnya D Biyoloji Program (Exobiology Prog ram ) ad altnda 1960 ylnda kuruldu. 1976 ylnda ilk Mars alm alar iin frlatlan V iking G revleri Uydu sunda, M arsta olas yaam form larn aratrm ak iin biyolojik deney de tasarlanm t. Devam eden yllarda da Mars zerine birok alma gerekletirildi. 21. yzyl da da NASAnn Gne Sistem ini aratran keif grevleri devam ediyor. Mars alm alarnn nem kazanm asnn nedeni, bir zamanlar Mars yzeyinde sv suyun olduu ve u anda da yzeyin altnda suyun olabilecei fikrinin kabul gr mesidir. Bizim iin de Dnya d yaam iin bakabilece imiz ilk yerlerden birisi M arstr. Mars K eif Program dahilinde gerekletirilen 2 001 M ars Odyssey grevi ile gnderilen uydu, Mars yrngesine oturduu 2001 y ln dan beri gnderdii 1 3 0 .0 0 0 den fazla fotoraf ile yzeyin je o lo jisin i, iklim ini ve m ineral yapsn ortaya koymaya devam ediyor. Spirit and O pportunity grevi ile 2 0 0 4 ylnda Mars yzeyine gnderilen iki ro b o t kilom etrelerce yol alarak yzeyden topladklar bilgi ve ektikleri grn tleri Dnyaya gnderdiler. Her iki ara da Mars yzeyin de ok eski zamanlarda su bulunan ve yaanabilir blgeler olduunu ortaya kardlar. 2 0 0 3 ylnda M ars yrngesi ne oturtulan Mars Express, yzey altnda bulunabile cek suyu aratrm aktadr. 2 0 0 6 ylnda Mars yrngesi ne oturtulan Mars Reconnaissance O rbiter Uydusu da, imdiye kadarki en gl kameray tam aktadr. Yzeyde bulunan bir yem ek taba boyutundaki cisim lerin dahi n et grntsn alabilm ektedir. Mars Bilim Laboratuvar grevi de, 2 0 1 1 yl sonlarna doru frlatlmay b ek li yor. Yzeyde hareket edebilecek bir ara olan laboratuvar m ikrobiyal yaam kantlarnn varln aratracak. Phoenix M ars grevi kapsamnda Austos 2 0 0 7 de frlatlan uydu, Mars yzeyinden rnekler topluyor ve yzeyinin analizini yapyor. M arsta suyun tarihini ve ge irdii farkl evreleri aratrmay ve yaama elverili b l gelerin bulunm asn am alyor. im diye kadar 25 G b.tan

SU ve DNYA DII YAAM

76

77

50 SORUDA YAAMIN TARH

fazla bilgi gnderm i durumda. Yzeyden toplanan kat rnekler ierisinde suyun varl da bulundu. Yakn gelecekte Mars iin olduu gibi, J p ite rin E u ropa Uydusu iin de benzer grevlerin balatlm as plan lanyor. 1989 ylnda frlatlan uzay m ekii G alileo, 1 9 9 5 -2 0 0 3 yllar arasnda J p iter yrngesinde dnerek gezegen ve uydular hakknda bilgi toplam t. Europe U ydusunun grntleri, bilim insanlarn, yzeyin altn da bir okyanus olduu ya da yzeyin buzla kapl olduu fikrine gtrd. 2 0 0 4 ylnda frlatlan ve M erkr G ezegenini aratra cak olan M essenger m ekii de 2011 ylnda M erkre ulaacak. M ekik ncelikle Vens Gezegeni yrngesine girerek, ektii grntleri Dnyaya gnderecek. Bu ge zegenlerden de daha fazla bilgi almamz m m kn olacak. Gne Sistem i dnda: Astronom lar Gne Sistemi d nda bulunabilecek Dnya benzeri gezegenleri de aratr yor. 2005 ylndan sonra Gne Sitemi dnda kefedilen Gliese 581 yldznn gezegenleri Gliese 58 1 c ve d, suyun sv halde bulunm a ihtim ali olduu dnlen gezegenler dendir. Avrupa Uzay Ajans tarafndan gelitirilen Darwin Uzay M ekii Projesi de Gne Sistem ine yakn yldz sis temlerindeki olas Dnya benzeri gezegenleri aratracak tr. 2 0 0 9 ylnda NASA tarafndan frlatlan Keppler mekii almaya devam ediyor. M ekikte bulunan teleskop saye sinde Gne Sistemi dnda Dnya benzeri Keppler 4b, 5b, 6b ve 7b ad verilen be gezegen kefedildi. G liese 5 8 d ve c gezegenleri, Dnyadan 194 trilyon km uzaklkta, G liese 581 yldznn evresinde dnyor lar. G liese 5 8 d yldz sistem indeki en dta bulunan ge zegen ve yldzn yaanabilir blge kuanda yer alyor. Bu yzden de okyanuslarla kapl olma ve yaam bulunm a ihtim ali en yksek olan gezegen. Dnya evresinde yrngede bulunan Hubble Uzay T elesko p u ve Spitzer Uzay T elesko p u ile Hawaide bu lunan K eck Gzlem Evi Teleskopu gibi yer teleskoplar uzay tarayarak yaanabilir gezegenleri bulm aya al m aktadr.

Buraya kadar anlattklar mz, Dnya d canl aratr malar iin gerekletirilen grevlerin bir ksm dr. Bu ve benzeri aratrmalarda peine dtm z nem li veriler sv su, karm ak organik m o lekller ya da basit hcre ya plardr. ekil 45. Murchison M eteorlarda ve uzay b o M eteoru'ndan bir para. luunda elde edilen organik m olekller: Dnya d yaam ile ilgili aratrmalarda, uzay boluunda ya da Dnyaya den meteorlarda bulunan karmak yapdaki organik m olekller nem li yer tutuyor. A stronom larn gl teleskoplarla uzay inceledik leri almalarda bulunan m olekller, yaamn belki de Dnyada balamad, bunun yerine uzayda bala yp Dnyaya tanm olduu fikrini destekliyor. Farkl gruplarn yapt alm alardan elde edilen yzlerce kar m ak organik m olekl arasnda, yapsnda amino asitle ri birbirine balayan peptid ba da bulunan asetam id (CH 3CONH2), antrasin (C 14H 10), naftalin (C 10H8), etil form at (C 2H3O CH O ) ve n-propil siyanid (C 3H7CN) gibi m olekller de bulunuyor. Bu gibi m olekller UV nm a maruz brakldnda su ve am onyak ile birleerek am i no asitleri ve yaam iin gerekli dier organik m oleklleri oluturabilir. Benzer m olekller Dnyaya den m eteorlarda da k e fedildi. zerine en o k allan m eteorlardan biri 1969 ylnda Avustralyaya den M urchison M eteorudur. M e teor zerinde bulunan organik m olekller arasnda farkl am ino asitler ve nkleik asit yaptalar da vard. M eteo run dt gnden itibaren, elde edilen sonular zerine tartm alar devam etse de, incelem e teknikleri gelitike, daha fazla karm ak yapda organik m olekl bulunmaya devam ediyor. 4 ,6 milyar yl nce olutuu hesaplanan m eteor, Gne Sistem inin ilk olutuu dnem den bize bilgiler veriyor. (ekil 45)

78

50 SORUDA YAAMIN TARH

SU v e DNYA DII YAAM

79

Dnya d zeki yaam formu bulunma olasl


Son olarak ise bir hesap yapabiliriz. Evrende yaamn sadece Dnyada bulunabileceini dnm ek o k m antk l olm ayacak gibi grnyor. SET program nn kurucusu Am erikal astronom ve astrofiziki Frank D rake, Sam an yolu Galaksisinde bulunan olas m edeniyetlerin saysn hesaplam ak iin 1961 ylnda bir form l gelitirm itir. Drake eitlii ad verilen bu eitlik kesin bir say verm i yor, ancak bir olaslk hesab yapmaya, uzayda bulunan ve bizim le balant kurabilecek m edeniyet saysn ngrmeye alyor. E itlik ksaca yle: N = R x f p x n e x f l x f i x f c x L E itlikte bulunan param etreler ve yanlarndaki ngr len deerler yle: N: Samanyolu Galaksisi'nde bulunan ve iletiim e gei lebilecek m edeniyet says. R: Samanyolu Galaksisindeki yldzlarn says (1 0 0 m ilyar). fp: Bu yldzlardan gezegenlere sahip olanlarn oran (yzde 2 0 -5 0 ) ne: Her yldz sistem inde yaam iin elverili ortama sahip gezegen says (1 -5 ) fl: Yaama elverili gezegenler arasndan yaam n ger ekten gelitii gezegenlerin oran (yzde 0 -1 0 0 ) fi: Bu gelien yaamlar arasnda zeki yaamn gelitii gezegenlerin oran (yzde 0 -1 0 0 ) fc: Bunlardan, uzaydaki sinyalleri aratrabilecek kadar gelimi teknolojiye ulaan ve iletiim e gem ek isteyen m edeniyetlerin bulunduu gezegenler (yzde 1) L: iletiim kurulan uygarlklarn var olma sresinin ile tiim e geebilm eye yetme olasl (1/ 1.000.000) Drake eitlii, kullanlan saylara gre ok farkl son u lar verir. E itlikteki deerler tahmine dayal ve bu tahm in ler de bilim sel gelim elerle birlikte geree daha yakla acak. Ancak en dk deerlere yakn bir hesap yaplsa dahi, elimizde zeki ve iletiim e geebilecek m edeniyetle rin bulunduu onlarca ya da yzlerce gezegen kacaktr.

ekil 46. ALH 84001 Meteoru ve alnan rneklerin elektron mikroskop grntleri, olas bakteri hcreleri.

1996 ylnda Antartikada bulunan ve ALH 84 0 0 1 ola rak adlandrlan dier bir m eteor da bize nem li bilgiler veriyor. M eteor Dnyaya 1 3 .0 0 0 yl nce dm ve yak lak olarak 4,5 milyar yanda. Aratrm aclar m eteorun M arsta yaam izi olasln gsterdiini dnyor. B u l gular arasnda tarihncesi bakterilerin kalnts olduu dnlen izler de var. (ekil 46 )

Dolayl yoldan aratrmalar


Dnya d yaam izlerini aratrm ann ik inci yolu ise dolayl yoldan yaam izlerine ulam aktr. Uzayda bu lu n mas m uhtem el zeki varlklarn izleri aratrlarak ve bu varlklara m esajlar gndererek sonu alnmaya all maktadr. Evrende bizim dmzda zeki varlklarn olup olm adn bilm iyoruz. A ncak olm am as iin bir neden yok gibi grnyor. SE T program (Search for E xtrater restrial Intelligence- Dnya D A kll Yaam Aratrm as) 1971 ylnda NASA tarafndan balatlan bir proje. Dnya d canl bir varlktan ya da teknolojik olarak gelimi bir medeniyetten gelen m esajlarn saptanm asn ve in celen mesini hedefliyor. Bilim sel yntem ler kullanlarak Dnya dndan gelen elektrom anyetik dalgalar saptanmaya a llyor. Ayn ekilde uzaya gnderilen belirli m esajlara da cevap bekleniyor. SE TI@ hom e Projesi ile ev bilgisa yarlarna kurulabilecek bir yazlm gelitirildi. Toplam da 2 9 0 .0 0 0 bilgisayarn katld ve 6 1 7 teraFLOP ilem ci gcne sahip bir a oluturuldu ve bu ekilde, saptanan saysz sinyalin incelenm esi iin gerekli bilgisayar gc salanm oldu.

YAAMIN KRONOLOJK GELM (Y K R )/B Y K PATLAMA

81

6.

Blm

YAAMIN KRONOLOJK GELM


6.1. BYK PATLAMA

I O I nasl ortaya kmtr?

I Evren

Yaam n dnya zerinde geirdii evreleri ve bugne nasl ulatn kavram ak istiyorsak, hikyeye en ban dan balam am z gerekir. ncelikle bilim dnyasnda, ev ren in nasl olutuu sorusuna verilen cevab ele alalm. Daha sonra Gne Sistem i ve Dnyanm nasl olutuu sorularm yantlayarak, yaam n dnyada ortaya kna ve geliim ine gelebiliriz. Evrenin oluumunu ve evrimini anlatan ve bilim in sanlar arasnda en yaygn kabul gren teori Byk Pat lam a (Big Bang) teorisidir. Bu teoriye gre evrenin tm, bundan 13,7 milyar yl nce ok scak ve youn kk bir nokta halindeydi. Evrenin tm ktlesi telbir noktada sak lyd. Byk Patlamadan sonra ise, evren gnmze kadar genilemeye ve ayn zamanda da soumaya devam etti. G a laksiler birbirlerinden uzaklatlar ve uzaklatka hzlar artt. Gnmzde de genileme devam etmektedir.

82

50 SORUDA YAAMIN TARH

Y K R /B Y K PATLAMA

83

Byk Patlama modelinin dayanak noktalar ve ortaya k


Byk Patlam a teorisinin ortaya k n salayan iki nem li dayanak noktasndan ilki, A lbert E in stein 'n 1 9 16 ylnda gelitirdii genel g relilik teorisidir. Bu te oride, Isaac N ew tonin yerekim i teorisi genelletirilm i ve y erekim i artk yerekim sel b ir alan olarak tanm lan m ak yerine, uzayn ve zam ann b k lm esi olarak tan m lanm tr. rnein, n G ne tarafndan bklm esi bu yolla aklanabilir. Byk Patlam a teorisinin dayanak noktalarnd an kincisi ise, k o zm o lo jik prensip fikridir. G enel g relilik teorisi zerine alan ve E in stein in de dahil olduu bilim ciler, yeni yerekim sel dinam ikleri tm evrene uygulamaya altlar. Bu prensip bir varsa ym ierm ekteydi: Evrenin tm n grm esek de gz lem leyebildiim iz ksm yla u son uca ulaabiliriz. M ad de, evrende hom o jen ve izotropik (her y ne doru eit dalm l) olarak dalm tr. Bu basit varsaym daha sonraki bulgularla desteklenm eye devam etti. zellikle Byk Patlam a srasnda kan ok yksek scakln ka ln ts diyebileceim iz kozm ik m ikrodalga ardalan n m nn evrenin farkl yerlerinde de h o m o jen sca k lk la r da olm as k ozm o lo jik prensip fikrini desteklem ektedir. Bu iki dayanak n oktas Byk Patlam a fikrinin tem elini oluturdu. 1917 ylnda evrenin genilem ekte olduu fikri sama bir fikir olarak kabul ediliyordu. Einstein, genel grelilik teorisini statik (sabit) bir evren m odeline uydurm ak iin kozm olojik sabit ad verilen bir sabit ekledi. G enel greli lik teorisini kozm olojiye uygulayarak evrenin geniledii sonucuna ulaan ilk kii, 1922 ylndaki yaynyla Rus bi lim ci Alexander Friedm annd. 1927 ylnda da Belika l rahip Georges Lem aitre, Friedm annm eitliklerini ve Einstein ile W illem de Sittern alm alarn kullanarak benzer ekilde evrenin geniledii sonucuna vard.

1929 ylnda Am e rikal astronom Ed win H ubbledan geldi. Hubble, yap t gzlem ler sonu cunda, Samanyolu G alaksisi dndaki galaksilerin bizden uzaklatklarn ve , ekil 47. Albert Einstein ve Edwin Hubble hzlarnn da bizden Mt. W ilson G zlem evi'nde, 1 93 1. uzaklklaryla do ru orantl olduunu gzlemledi. Daha sonralar Hubble Yasas olarak adlandrlan bu yasaya gre, uzak galaksi lerden gelen k, galaksi bizden uzaklatka spektrum da krmzya doru kayyordu. Uzaklam a hzlar da uzak lklaryla doru orantlyd. Hubble, k spektrum undaki deim eleri gzlem leyerek evrenin geniledii sonucuna ulamt. Evren gerekten de her yne doru geniliyor du ve Einstein sonradan getirdii kozm olojik sabitle bir hata yapm t. H ubblem bulduu sonu ise E insteinin genel grelilik teorisine ve evrenin h om ojen ve izotropik olduu fikrine uyuyordu. (ekil 4 7 )

lk atom hipotezi (Byk Patlama)


1931 ylnda George Lem aitrenin ne srd ve ilk atom hipotezi adn verdii hipotez daha sonralar B yk Patlam a teorisi olarak anlmaya balanm tr. Lem a itre, ne srd hipotezde, zamanda yeterince geriye gi dildiinde var olan tek bir atoma ulalacan nerm iti. Byk Patlama terim ini ise ilk olarak Ingiliz bilim ci Fred Hoyle 1949 ylnda BBC Radyosunda yapt bir rpor taj srasnda, bu teoriyle dalga gem ek iin kullanm tr. Fred Hoyle, Byk Patlama kart olarak bilinen sabit evren m odelinin savunucusuydu. George Gamow ve a lma arkadalar, Lem aitren in Byk Patlam a teorisine destek verdiler ve Byk Patlam a ekirdek sentezi fikrini ne srerek kozm ik mikrodalga ardalan nm nn varl n tahm in ettiler.

Gzlemsel ilk destek


A ncak tm bu hesaplam alara karn, gzlem sel kant

84

50 SORUDA YAAMIN TARH

Y K R /B Y K PATLAMA

85

B y k P a tlam a k u ra m n n d e ste k le ri M atem atiksel hesaplam alar dndaki nem li ilk gz lem sel destek, yukarda bahsettiim iz H ubblem yapt gzlemlerdi. G zlem sel desteklere, ekirdek sentezinin ve kozm ik m ikrodalga ardalan nm nn bulunm as da eklenebilir. ekirdek sentezi: ekirdek sentezi, ar olan elem ent lerin hafif olan elem entlerin birlem esiyle olum asdr. Byk Patlam a teorisinin ngrlerinden birisi ilk evrenin ok scak olduudur. Patlamadan 1 saniye sonra scaklk 10 milyar derece civarndayd ve evren ntron, proton, elektron, anti-elektron (pozitron), foton ve ntrinolardan olum utu. Evren souduka ntron ve protonlar birleerek dtoryumu (h id rojenin izotopu) oluturdular, ilk dakika iinde dtoryumdan helyum ve bir m iktar da lityum olutu. te bu ilk hafif elem entlerin olum asna Byk Patlama ekirdek sentezi ad verilir. H idrojen ve helyum un evrendeki oran, teorik hesaplamalara gre B yk Patlam adan arta kalm as gereken helyum ve hidrojen m iktaryla uyumludur. Evrendeki hafif elem entler ilk pat lama srasnda retilirken, dier ar elem entler sonradan retilm itir. Lityum dan daha ar elem entler yldzlarda retilir. Yldz evrim inin son aamalarnda helyum , kar bon, oksijen , silikon, slfr ve dem ire yaklr. Daha ar elem entler de spernova patlam alarnda ya da sper dev yldzlarda retilir. K ozm ik m ikrodalga ardalan nm : Byk Patlam a te orisinin bir ngrs de udur: lk evren ok scakt (1 0 milyar derece) ve geniledike soumaya balad. yle bir scakla gelindi ki, elektronlar ekirdeklerle birleerek ntr atomlar oluturdu. Bu zamandan nce evren opakt. I geirm iyordu. Bunun nedeni de serbest olan elektronlarn datacak olmasyd. Ancak elektronlar atom larn yapsna katldka, evren saydam hale gelmeye balad, ite bu ilk fotonlarn m alar kozm ik m ikrodal ga ardalan nm olarak bilinir ve o zamandan beri ev rende yol almaya devam etm ektedirler. G ittike daha silik ve dk enerjili olm ulardr. Bugn kozm ik mikrodalga

ekil 48. W MAP Uydusu (W ilkinson Microwave Anisotropy Probe W ilkinson M ikro dalga Anizotropi Sondas), tm gkyzndeki kozmik m ikrodalga ardalan nm ndaki scaklk d a lg ala nm a la rn, derecenin 1 0 0 .0 0 0 'd e 1'i hassaslyla lebiliyor. Evrendeki ortalam a scaklk 2 ,7 2 5 Kelvin (-2 7 0 ,2 7 5 C). ekildeki farkl tonlar, farkl s blgelerini gsteriyor.

ardalan nm o k souktur (m utlak sfrn sadece 2 ,7 2 5 C zerindedir, yaklak -2 7 0 C ) ve gzle grnm ez. An cak tm evreni doldurm utur. Evrendeki scaklk dal m da hom ojendir. (ekil 4 8 ) Bu derece h om ojen dalm bir m ann kayna tek bir nokta olm aldr. Bu da Byk Patlama teorisini destekleyen sonulardandr. Kozm ik m ann zelliklerini aratrarak evrenin ilk zamanlar hakknda bilgi sahibi olabiliriz, ilk defa 1965 ylnda New Jersey de bulunan Bell Telefon Laboratuvarnda radyo alcs ile alan Arno Penzias ve Robert W ilson tarafn dan gzlenm itir. Penzias ve Robert bu keifleri sayesinde 1 9 7 8 ylnda Nobel F izik dln kazanm tr. Son dnem bulgular: Teleskop teknolojisindeki ge lim eler ve uydular araclyla elde edilen bilgiler sonu cunda 1 9 9 0 l yllarda ve 21. yzyln balarnda Byk Patlama ile ilgili nem li ilerlem eler yaand. 1989 ylnda frlatlan CO BE Uydusu (Kozm ik Arkaplan Aratrma Uy dusu), 1993 ylnda kullanlm aya balanan Hubble Uzay Teleskopu ve 2 0 0 1 ylnda frlatlan W M AP Uydusu ev renin srlarm aratrmaya devam ediyor. COBE ile elde edilen bilgiler, kozm ik m ikrodalga ardalan nm ile il gili ne srlen tahm inleri dorulad. W M AP ile zellikle

86

50 SORUDA YAAMIN TARH

Y K R /B Y K PATLAMA

87

Byk Patlam adan arta kalan kozm ik mikrodalga ardalan n m kullanlarak evrenin detayl grntleri aln d. Bu yolla evrenin ya 13,7 milyar yl olarak hesapland ve zellikle im e teorisinin doruluu gsterildi. 2 0 0 9 ylnda frlatlan Planck Uzay M ekii de, 2 0 1 2 ylndan itibaren arkaplan m alarn aratrmaya balayacak.

ime teorisi (kozmik ime ya da ien evren)


ime teorisi (enflasyonist evren m odeli), Byk Patlam anm ilk anlarnda evrenin ok hzl bir ekilde ge nilediini ne srer. Evrenin 13,7 milyar yl boyunca g rece olarak kadem eli genilediini syleyen standart B yk Patlama teorisindeki eksikleri tam amlamak amacyla gelitirilm itir. Gnmzde Byk Patlama teorisinin bir uzants olarak kabul edilm ektedir. Byk Patlam ada ev renin nasl gelitii aklanrken, ien evrende ise daha ok ilk genilem e ve nedenleri aklanr. 1980 ylnda Alan G uth, Andrei Linde, Paul Steinhardt ve Andy A lbrecht tarafndan gelitirilm itir. im e hzl ve gldr. Nedeni kesin olarak bilinm ese de, ar m ik tardaki kararsz enerji ok ksa bir sre ierisinde evrenin o k hzl genilem esine yol am tr. Evrenin dorusal b o yutu saniyenin ok kk bir ksm nda ~1026 kat artm tr. Bu modelle, Byk Patlama modelinde aklanam ayan evrenin hom ojen olma nedenlerine, ufuk problem ine ve dz evren sorunlarna cevap verilebilm itir. Standart B yk Patlam ada nerildiinden ok daha kk b ir nokta evrenin balangc olarak kabul edilmitir.

Byk Patlam a annda: Maddeyi oluturan paracklar meydana gelir. Bu oluum un nasl olduu bilinm em ek tedir. Bu paracklardan bizi ve evreni oluturan madde oluacaktr. Madde ve enerji son derece youn bir yapda bulunur, yle ki 1 ay ka byklkteki evren 100 m il yon trilyon trilyon trilyon kilo edecektir. Evren 2,5 cm apndadr. ilk dakika: Evrendeki tm hid rojen atom lar olu mu durumdadr. Eer evrenin scakl ve younluu bu derece yksek kalmaya devam etseydi, hidrojenin tamam dier kimyasal elem entlere dnm olacakt. Hidrojen olmadan da su olm ayacakt ve sonu olarak yaam da or taya km ayacakt. Evren ok hzl byyerek 5 0 0 trilyon km apna ulat. Patlam adan 3 0 0 binyl sonra: Patlamadan 3 0 0 binyl sonra, evren hzl bir ekilde genilemeye ve soumaya devam etse de, hl yanc scakln koruyordu. O rtam da sadece en basit elem entler bulunuyordu. ounlukla da hid rojen ve helyum vard, ilk yap oluum larnn izleri ortaya km aya balyordu. Bu ilk madde gruplarnn e kim gleri evredeki m addeleri de ektike bymeye devam ettiler. Evrende tespit edebileceim iz en eski k, bu zamandan kalm adr. Evren genilem eye devam etti; 7 5 0 .0 0 0 x trilyon km apndayd. Patlam adan 1 0 0 m ilyon yl sonra: Evren yeterince so uduunda, artk grnr bir k kalm am t. lk yldz lar daha olum adlar. Sadece karanlk vard. Evrenin ap 25 milyon x trilyon km ydi. Patlam adan b ir m ilyar y l sonra: lk milyar ylm n ce sinde ilk yldzlar parlamaya balam lard. Birok yldz yerekim i kuvvetleri sayesinde bir araya gelerek galaksi leri oluturdu. G enilem e srm ekteydi, evren 100 m ilyon x trilyon km apndayd. Patlam adan 13, 7 m ilyar y l sonra: Binlerce galakside, m ilyarlarca yldz ve gezegen bulunuyor. Gne Sistem i miz evrende bir atom boyutunda. Gnm zde genilem e devam ediyor, evren 1 milyar x trilyon km apnda. (e kil 4 9 )

BYK PATLAMANIN KRONOLOJS:


Byk Patlam anm hem en n cesi: Byk Patlam adan hem en ncesinin nasl olduunu h i kim se bilm em ek tedir. u andaki en iyi teori ien evren m odelidir. Bu m odele gre Byk Patlama ncesinde evren ok youn ve kararsz bir enerji tr ile doludur ve Byk Patlama ile birlikte bu enerji, maddeyi oluturan m olekllere d n ecektir. Ancak kim se uzayn ve zamann ilk defa nasl ortaya ktm bilm em ektedir.

88

50 SORUDA YAAMIN TARH

YK R /B Y K PATLAMA

89

Kozmik mikrodalga arkaplan mas 400 bin yl sonra \

Karanlk enerji ivmeli genileme Karanlk ca ya _ . . . Galaksllf ' n- , . gezegenlerin vb gelimesi

ime

Kuantum dalgalanmalar

lk yldzlar 400 milyon yl sonra Byk patlama genilemesi 13,7 milyar yl

ekil 4 9 . Evren 13,7 milyar yldr genilemeye devam ediyor.

Hj " T I Evrenin I / I yap maddesi nedir?


Evrenin nasl olutuunu daha iyi kavrayabilm ek iin cevaplanm as gereken nem li bir soru da evrenin yapta larnn neler olduu sorusudur. Trilyonlarca kilom etrelik geni bir alana yaylm galaksilerden, yldzlardan, geze genlerden bahsediyoruz. Gnm zde evren 1026 m b o yunlarndadr ve bu kadar alan ierisinde yaklak olarak 1 0 u galaksi (yani 100 milyar galaksi), O21 yldz bulunur. Toplam atom says ise 1078 ve foton says da 1088 gibi yksek saylardr. Peki byle bir yapy oluturan temel bileenler nelerdir? Bizim bildiim iz doa kanunlar ya da gzlem lerim iz dnda meydana gelen baz baka fizik ka nunlar ya da maddeler sz konusu mudur? P aracklarn bo yu tlar: evremizde grdmz h er ey, hava, su, ate ve toprak bir m etrenin on milyarda biri byklndeki atom lardan oluur. Bu atom lar ise ken dilerinden on bin kat k k ekirdek ile bir milyar kat kk elektronlar ierir. ekirdek ise yapsnda k en d in den on kat daha k k ntron ve protonlar ierir. Daha

da derine gidecek olursak, proton ve ntronlar da temel parack olan kuarklardan meydana gelm ektedir. Bylesine kk varlklarn davranlar da bizim gn lk hayatta gzlemlediimiz cisim lerden farkldr: Btn olarak kuantum m ekanii olarak adlandrdm z bu prensiplere gre, Heisenberg belirsizlik ilk esinde b elir tildii gibi, bu paracklarn konum lar ne kadar yksek hassasiyetle llrse, hzlar o kadar az hassasiyetle b ili nebilir; buna ek olarak hem dalga hem parack zellikleri gsterirler; devinim esnasnda belli bir yrnge izlem ez ler; verilen bir durumdan dierine geerken gzlenem eyen ara durum lar yaarlar. Bu gibi zellikler yznden ev rende bizim grdmz ve bildiim iz Dnyann fiziksel zelliklerinden farkl kurallar da sz konusudur. 2001 ylnda uzaya gnderilen W MAP Uydusu (W ilk in son M icrowave Anisotropy Probe - W ilkin son M ikrodalga Anizotropi Sondas), Byk Patlam adan 3 0 0 .0 0 0 yl so n ra ortaya kan kozm ik m ikrodalga ardalan nm ndaki ok kk scaklk farklarn (bir derecenin 1 0 0 .0 0 0 de biri kadar) gzlem liyor. Evreni oluturan madde ve ener jin in bir saym, W M APm yapt lm lere dayanyor. W M AP, Byk Patlam a m odelinde ngrlen evrenin yo unluu ve ierii gibi sorulara yant verebilir. G zlem lenebilir evrende yaplan bu tr lm ler, ga laksilerin hesaplanabilen maddeden daha fazla bir madde nin ekim etkisi yznden ok hzl dndn ortaya karm tr. Kaynan bilm ediim iz bu maddeye karanlk madde (evrenin yzde 2 3 n kaplar) adn verm ekteyiz. Karanlk madde yerekim sel bir g yaratr, ancak yanstm az ya da sourm az. Byk ihtim alle atom alt bir ya da daha fazla parack trnden oluuyor ve norm al atomlarla ok zayf etkileim ierisinde. Yeni yaplan par ack hzlandrm a deneyleri, karanlk m addenin ieriini ortaya karacak yeni fikirler verebilir. te yandan, yine son yllarda yaplan lm ler gster m itir ki, itici bir karanlk en e rji (evrenin yzde 7 3 n kaplar) sayesinde evren hzlanarak genilem ektedir. K saca, evren artarak genilemeye devam ettiine gre, bu

90

50 SORUDA YAAMIN TARH

YK R /B Y K PATLAMA

91

ekil 50. Evrenin yapsnn byk


ksmn karanlk enerji ve karanlk madde oluturur.

art salayan bir enerji de olm aldr. Kozm ik ge nilem eyi hzlandran ka ranlk enerji, evrenin en byk paras olm a zel liinin yan sra en gizem li blm olma zelliini de srdryor. Geriye kalan yzde

tuvar. O nlarca lken in katkda bulunduu ve bin lerce aratrm acnn alt m erkez, yzlerce niversite ile ibirlii iind e aratrm alara devam ediyor. M erkezin tem el fonksiyonu yksek en erji g erektiren fizik aratr malar iin parack h zlan d rc ve dier yaplarn sa lanm as. B y k H ad ron a rp trc s Yerin 100 m altnda bulunan Byk Hadron arptrcs (LH C) 27 km lik sper-iletken em bere sahip ve 14Tevlik ktle m erkezi enerjisinde proton-proton ve kurun-kurun arpm alar yaplmasna olanak salyor. Deneylerde standart m odel Higgs m ekanizm as ve stan dart model tesi m odellerin ngrd paracklarn gzlenm esi am alanyor. LHC hzlandrcsnda proton dem etleri farkl ynlerde gnderilerek k hzna yakn hzlarda arptrlyor ve bylece Byk Patlam ann ilk anlarndaki ortam oluturulm aya allyor. (ekil 51) 2 0 0 8 ylm a kadar birok aratrm ac sim ulasyon a lm alar ile deney sonucu orekil 51. CERN'de bulunan la y 3 kacak verilerin yorumByk Hadron arptrcs ,, u , T Fj v . (Large H adron Lo lld e r) yerin 100 m altnda ina edilm itir ve 27 km 'lik sper iletken embere

4 ,6 lk ksm ise bizim b il diimiz anlamda atomlardan oluuyor. (ekil 5 0 ) Proton, ntron ve elektronlar atomu oluturan temel yaptalar dr. evremizde grdmz her eyin yapsnda b u lu nurlar. Elem entler de, yaplarnda farkl saylarda olsa da bu tem el paracklar bulundurur.

-| Q I

CERN deneyleri ile yaplmak istenen nedir? Byk Patlama tekrar gerekleecek mi?

lanmas uzerm e altlar ve 2 0 0 8 ylnda da LHC zerincleki dedektrler kozm ik nlarla test edilmeye baland. j 26 Kasm 2 0 0 9 tarihinde ilk proton demetleri gnderile rek testler gerekletirildi ve Aralk 2 0 0 9 banda da pro-

. . .

G etiim iz yllarda lkem izde de byk bir heyecan la takip edilen ve beraberinde birok tartmay getiren CERN deneyleri, bizlerin bilim le ne kadar ilgili olabilece imizi ve bilim sel gelim eleri takip etm ekten keyif ald mz gsteren gzel bir rnek. Deney m erkezi ve yr tlen deneyler dolaysyla, tm hatlaryla yzyln deneyi olarak adlandnlmay hak ediyor. CF.RN m erkezinde b u lunan Byk Hadron arptrcsnda (Large Hadron C ollider) yaplan deneyler onlarca yl devam edecek. Bu deneylerle maddenin temel yaptalar hakkm daki eksik bilgilerim iz ve evrenin evrimi zerindeki sorularn cevap lanm as amalanyor. CERN Avrupa P arack Fizii Laboratuvar (Th e E u ropean O rganization for N uclear Research) 1 9 5 4 ylnda sv irede kurulan dnyann en byk parack labora-

sahp,r' *"

92

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

93

2,36 TeV ktle merkezi enerjilerine kadar kld ki, bu enerji seviyesine ulaabilen baka bir parack hzlandrc bulunmamaktadr.
M addenin yaptalarnn ne olduunu aratran deney lerde, geldiimiz son nokta olan standart m odel iin gerek li olan bir parack (Higgs parac) henz kefedilmedi. Standart m odele gre maddenin yaptalar olan lepton, kuark ve bunlar arasndaki etkileim leri gerekletiren arac paracklardr. M odele gre, paracklarn ktlele rinin nereden geldiklerini aklayabilm ek iin Higgs alan ad verilen ve henz kefedilm eyen bir etkileim alanna ihtiya vardr. Bu yzden Higgs paracnn aranm as ve zelliklerinin ortaya karlm as standart m odel asndan son derece nem lidir. Evrenin tem el ilkelerini anlam ak iin yapmamz ge reken deneyler LH Cnin ulaabilecei yksek enerjileri gerektiriyor. Yerin 100 m altnda yer alan 27 k m lik bir tnele ina edilen LHC (Byk Hadron arptrcs) ile yaplan deneyler CMS, ATLAS, LHCB ve ALCE olarak isim lendirilm itir. Protonlar, 14 TeV enerji oluturacak ekilde arptrlarak evrenin ilk anlarn daha iyi anla mamz am alanm aktadr. Ancak m utlak anlamda elde edilen enerji bir k ibrit ateinden fazla deildir.

kam asna izin verm eye cek kadar gl olan ktle ekim in e sahip cisim lere kara delik d enilir. n em li olan cism in k tlesi ile younluunun orandr. H acim sfra giderken k t
ekil 52. Merkezde bulunan
kara delik evresinde dnen gkcisim lerini gsteren bir izim.

le sonsuza gider. D olayl yoldan da olsa b iro k kara d elik uzayda g zlem len m itir. Y ksek ekim kuvveti nedeniyle k bile kara delikten kaam az. Biz ancak yldzlar kara d elikler ta rafndan yutulduklarnda kara d eliklerin varln gz lem liyoruz. (ek il 5 2 ) D k de olsa ayn teh like Dnya iin de m evcuttur. A ncak laboratuvar ortam nda oluan kara delikler bunlardan deildir. LH C de o lu abilecek m ini kara delikler atm osferde de uzaydan gelen kozm ik n larn atm osferdeki atom lara arpm as ile oluabilir. Laboratuvar ortam nda ise en erji m iktar o k daha d ktr.

6.2 GNE _ D SSTEM ve DNYA

Byk Patlama ve kara delikler


CERN deneyleri 2 yldr kam uoyunun gndeminde. B unun en nem li nedenlerinden birisi, deneyler iin k ul lanlan isim: Byk Patlama deneyleri. Bu yzden insan larn ilgisini ekiyor ve baz yanl anlamalara da neden oluyor. rnein, deneyler srasnda oluabilecek bir kara d eliin tm evreni yutabilecei gibi. Bu deneylerde Byk Patlama tekrardan oluturul m uyor. Ancak o zam anki enerji younluuna ulalmaya allyor. Elde edilen enerji olduka dk, ancak pro tonlarn boyutlar da o k k k olduundan en erji yo unluu ok fazla. Kara delik ise dnld kadar gizem li deildir. ekim alan h er trl m addenin ve n kendisinden

Gne Sistemi nasl olutu?


Bir nceki sorum uz Byk Patlam ann nasl gerekle tiine ilikindi. Bu soruyu yantladktan sonra imdi za manda ilerlem eye devam edelim. D nyam zn da iinde bulunduu Gne Sistem i ve dnyamz ne zaman ve nasl olutular? Gne Sistem inin gnm zden yaklak olarak 4 ,6 milyar yl nce olutuu tahm in ediliyor. G nein oluu munu takip eden dnem de gezegenlerin oluum sralar

94

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM ve DNYA

95

kesin olarak bilinm ese de tm sistem in yaklak 100 m il yon yllk bir zaman dilim inde oluum unu tam amland kabul ediliyor. Oluum s recini 3 tem el aama halinde zetlem ek m m kn. 1) lk m ilyon yllar: Yldz dnem i; evresel materyalin birikm esiyle m erkezde G nein olutuu dnem. 2) lk on m ilyon yllar: D isk dnem i; G ne evresin deki evresel diskin kaybolarak gezegenlerin olumaya baladklar dnem. 3) lk yz m ilyon yl: Tel rik dnem ; kayasal gezegen lerin olutuklar ve farkllatklar, okyanuslarn ve at m osferlerin ortaya ktklar dnem. Srecin nasl ilediini takip edebilm ek zor olabilir. Ancak ekil 53 tem el olarak nasl basam aklardan geildi ini anlam anza yardm c olacaktr. Srecin m ilyonlarca yl kapsad unutulm am aldr. ncelikle, uzayda bulunan toz ve gaz bulutlar, yksek bir ihtim alle yakn bir yldzda meydana gelen spernova
e k i l 5 3 . Gne Sistemi, yaknlarda meydana gelen bir spernova
patlam as sonucu olum aya balad. Toz ve gaz bulutu nce skarak ie kmeye balad ve devam nda da merkez evresinde bir disk yaps oluturdu. G ezegenler de, zam anla temizlenen disk iinde olumaya baladlar.

patlamasyla (o k gl yldz patlam as) kararsz/dzen siz bir hale geti. Patlamadan kaynaklanan ok dalgalar toz ve gaz bulutunu sktrm aya balad. Skm a sonucu bulut ie doru kerek i ksm larda daha yksek k t leye ulat. O halde ilk bata bir skm a ve maddenin ie doru km esi var. Sonraki adm ise kendi evresinde dnm e hareketi ve disk yapnn olumas. Spernova patlam asndan gelen ok dalgas, skan bulutun asal bir m om enttim kaza narak dnm esine neden olmu olabilir. Toz bulutu d nn hzlandrdka, yerekim i ve toz bulutunun bu harekete kar direnci sayesinde, toz bulutu dnm e ekse nine dik bir ekilde yasslamaya balad. Evrende, kendi evresinde dnm ekte olan dev boyutlardaki bu tr yass toz ve gaz bulutlarna solar nebula ad verilir. Bir sonraki adm, G nein artk yanmaya balad adm olarak tanm layabiliriz. Ksaca yle bir yol izlemi olabilir: M addenin ie doru km esi, dngsel hzdaki art (rotational speed) ve yerekim inin de etkisiyle, m er kezde ok yksek m iktarlarda kin etik enerji olutu. Bu enerjin in baka bir yere aktarlam am as nedeniyle diskin m erkezindeki s giderek artmaya balad. M erkezin ar snm as ekirdek birlem e reaksiyonlarn balatt. Hid rojen atom lar birleerek helyum atom unu oluturmaya baladlar. te bu evrede G nein artk tututuunu sy leyebiliriz. evredeki toz ve gaz bulutunun byk ksm ise ilk gne rzgryla datlm oldu. G nein bu ilk aam asna T-Tauri faz ad verilir. Bu durumda merkez ile evresi arasnda net bir fark olutuunu syleyebiliriz. Merkez daha youn ve scak olurken, evresini saran disk eklindeki bulutun kenarla rna doru ise daha souktu. Disk gittike inceldi ve parlikller bir araya gelmeye ve birbirlerine yaparak boyut a bymeye baladlar. Bu cisim ler daha sonra oluacak gezegen ve dier cisim lerin temelini oluturdular. Gne Sistem ide olduu gibi, m erkezdeki yldzn evresinde bir disk eklinde gezegenler, gezegenlerin uydular, asteroidler ve dier kk gkcisim leri olutu. Bulutun merkezine

96

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

97

yakm yerlerde, Dnya gibi sya dayanabilecek kay asal ge zegenler oluurken, diskin d blgelerinde ise, Jpiter gibi devasa ve daha ok buz yapdaki gezegenler olutu.

malar sonucunda, eer var ise, tm okyanuslar buharla m olmaldr. arpm alar Gne Sistem indeki dier gezegenlerin e killenm esinde de nem li rol ald. Sonraki blm de Ayn nasl olutuundan bahsedeceiz. Dnya gkcisim lerinin bom bardm an altndayd ve Mars byklnde olduu dnlen bir gkcism inin arpmasyla, Dnyadan k o pan paralar Dnya evresinde yrngeye girerek Ay oluturdu. Ayda bulunan kayalar, ap 100 km civarnda olan gkcisim lerinin, gnm zden 3 ,8 milyar yl n ce sine kadar Dnya ve Ay zerine arpmaya devam ettii ni gsteriyor. M erkr ve Vens zerinde bulunan derin kraterler, bu gezegenler zerinde de byk arpm alarn olduunun iaretidir.

20

Dnya ne zaman ve nasl olutu?

Birikme
Gne Sistem inin m erkezinde G ne oluurken, m er kezden 150 m ilyon km uzakta da Dnya olumaya bala d. Dnyann oluma evresinde Dnyaya dt d nlen kond ritik m eteorlarda (silikat k recikler ieren ve Gne Sistem inin oluum undan beri ok az deiim gs teren m eteorlar) yaplan radyom etrik (207Pb/206Pb) ya tayin deneyleri, dnyam zn yaklak olarak 4 ,5 6 milyar yl nce olumaya baladn gsteriyor (yaklak yzde l lik bir hata payyla). G ezegenlerin birikerek olumalar zerine yaplan teorik m odeller, G ne Sistem i ierisin deki gezegenlerin ilk oluum evrelerinin 1 0 -1 0 0 milyon y llk b ir zaman kapsadn ortaya koyuyor. Nasl Gne toz ve gaz bulutunun ie kerek birikm e siyle olutuysa, Dnya da benzer ekilde toz bulutunun ie doru kerek younlam asyla olumaya balad ve yerekim inin de etkisiyle saysz m ateryali zerinde birik tirerek byd. O halde, yava yava b ir araya gelen ve gittike byyen bir yapdan bahsedebiliriz.

Metal younlukta ekirdek yaps


Gne Sistem inde olum akta olan kk ilkel geze genlerin birounun (m erkezinde) dem ir ekirdek yaps bulunuyordu. Dnya zerinde m ateryal biriktike, demir ekirdek yap Dnyanm silikat yapdaki m antosuyla ( e kirdein stn saran katm an) yeniden bir denge iine girdi ve demir seven elem entler Dnyanm zaten demir bakm ndan youn olan ekirdeinde toplandlar. Youn luklar yksek ar elem entlerin (dem ir ve demir seven elem entlerin) m erkezde birikm esine dem ir katastrofu ad verilir. Bu olay ile Dnyann ilkel m antosu ile m erkezde ki ekirdei arasndaki ayrm da olumaya balam oldu. Tabakalar arasndaki ayrm tahm ini olarak Dnyann olumaya balam asndan 10 m ilyon yl kadar sonra mey dana geldi. Dnyanm sahip olduu tabakal yapnn, m anyetik yapsnn gelim esinde de etkisi vardr.

Gkcisimlerinin arpmas
lk gezegenin (proto-planet) bym esinde, byk ih tim alle yzlerce k k ilkel gezegenin arpm asnn etkisi byk oldu. O lum akta olan D nyaya arpan gkcisim le rinin bazlarnn boyutlarnn Ay kadar ya da daha byk olduu dnlyor. Ayn byklnn Dnyanm se kizde biri olduu dnlrse, bu arpm alarn ne kadar iddetli olduu anlalabilir. Byk ihtim alle bu arp

Yzeyin ekillenmesi
Bu ilk nc gezegenin birikm esi srasnda, Dnya y zeyinin Si ve O ieren gaz silikat bulutuyla evrelenm i olm as yksek bir ihtim aldir. Zaman ierisinde bu gaz bulutu younlaarak Dnya yzeyindeki kaya yapsn oluturm utur.

98

50 SORUDA YAAMIN TARH

Y K R /G N E S STEM v e DNYA

99

Yeni oluan T Tauri yldzndan (G nein ilk hali) kay naklanan solar rzgrlar Gne Sistem inde bulunan ve he nz bir gezegenin yapsna girmemi toz bulutunu Gne Sistem inden temizledi. lk atmosfer byk ihtimalle solar nebuladan geriye kalan hidrojen ve helyum gibi hafif ele mentlerdi, ancak gne rzgr ve Dnyann ss bu ilk at mosferi de uurmu olmaldr. Bu durum Dnyanm ap imdiki apnn yzde 4 0 ma geldiinde deiti ve yerekimi kuvveti sayesinde, su da ieren bir atmosfer olutu. Grl d zere, Dnya kademeli olarak byyen bir yap halin dedir. Merkezde bulunan metaller sayesinde oluan ekim Dnyanm bymesini kolaylatrmaktadr. Ayn ekim Dnya evresinde bir atmosferin olumasn da salyor.

materyal de Dnyann i yaps hakknda bilgi al mam z salayacaktr. Dnyanm i yaps ile ilgili bilgi aldmz dier kaynaklar ise Dnyanm, G nein evresindeki e k i l 5 4 . D nya'nn i yaps temelde hareketi, yerekim i kuv kademeye ayrlmtr. Merkezde veti, m anyetik alanlar ve ekirdek, zerinde m anto ve en dta Dnyanm iinden yaylan da kabuk. s akdr. rnein, g nm zden 3 0 0 yl nce ngiliz bilim adam Isaac Newton gezegenleri ve yerekim i kuvvetini kullanarak Dnyanm i ksm nn yzeyinden iki kat daha youn olduunu h e saplam tr. O dnem den beri Dnyanm i yapsyla ilgili bilgilerim iz ok daha fazla olsa da, Newtonm ngrs hl geerliliini koruyor. ok tem el olarak incelem ek gerekirse, ana tabaka nn, Dnyanm jeo lo jik yapsn oluturduunu syleye biliriz. (ekil 54) e k ird e k ta b a k a s Dnyam n m erkezinde ekirdek tabakas bulunur ve Dnya hacm inin yzde 15ini oluturur. ounlukla demir ve nikel ierir. Az m iktarda da kkrt ve oksijen gibi daha hafif elem entlerin bulunm as olasdr. ekirdek yaklak olarak 3 5 5 0 km yarapmdadr. D ksmda bu lunan 2 2 5 0 km lik ksm svdr. Sv blgedeki akntnn Dnyamn m anyetik alann oluturduu tahm in edilm ek tedir. En i blgenin ise, ekirdein d blgesi ile ayn yapda, ancak kat olduu sanlm aktadr. Dnyamn merkezine doru gidildike s artar. En d taki kabuk tabakasnn dibinde scaklk yaklak 1000 C civarndadr. Aalara inildike her k m de 1 C artacaktr. Jeologlar ekirdein d ksm nn ssnn 3 7 0 0 -4 3 0 0 C, i ksm nn ise 7000 C olduunu tahmin ediyorlar. Bu scak lk Gnein yzey scaklndan daha fazladr, ancak yk sek basn nedeniyle i ekirdek kat kalabilmektedir.

-1 I Dnya'nn i yaps Am I I nasldr?


Burada, Dnyann gnm zdeki yapsnn tem el hat larndan ksaca bahsedebiliriz. Bu bizim oluum srecinin nasl gerekletiini ve nasl sonulandn anlamam z salayacaktr. Jeologlar Dnyamn i yapsn dorudan incelem e ansna sahip deiller. Alabilen en derin delik lerde bile yaklak 13 km derinden rnek alnabiliyor. An cak jeologlar, Dnyann i yapsnn ince olan d kabuk yapsndan ok farkl olabileceini biliyorlar. Dyanm i yapsn anlam ak iin jeologlarn kullan d bir yol, Dnyaya dm olan m eteorlarn kim ya sal yaplarn incelem ektir. K ondrit ad verilen meteorl r, G ne Sistem inin ilk zam anlarndan kalan m eteorlardr ve Dnyaya dtklerinden beri deimemilerdir. Bu yzden jeologlar bu m eteorlar Dnyann derinlerinin kim yasal yapsn anlam ak iin kullanabilirler. D eprem lerden gelen titreim lerin incelenm esi ile de bilgi edinile bilir. Titreim lerin hz ve hareketi geldii tabaka hakkn da bilgi verecektir. V olkanik aktiviteler ile yzeye tam an

100

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

101

Manto tabakas
ekirdek ile d kabuun arasnda 2 9 0 0 k m kadar derine inen m anto tabakas Dnyan n hacm inin yzde 8 4 n oluturur. M antonun akkan bir yapda oldu u ve Dnyanm en d tabakas olan kabuk tabakasnn m anto tabakas zerinde yzd sylenebilir. Bu yava hareket de ktalar ok yava bir hzla hareket ettirecek ve benzer ekilde de deprem leri, volkanlar ve da sralarn oluturacaktr.

JL X . I nasl olutu?
NASAnn dzenledii Apollo Uzay Program kapsa mnda Aydan getirilen kaya paralarna yaplan radyom etrik tarihlem e testleri, Ayn 4 ,5 2 7 10 m ilyon yanda olduunu gsteriyor. Bu da Ayn G ne Sistem inde bu lunan dier gkcisim lerinden (gezegen vb.) yaklak 3055 m ilyon yl daha gen olduu anlam na gelm ektedir.

7 7 l Ay

Kabuk tabakas
Dnyann dnda bulunan 8 -4 0 km lik tabaka ise kabuk adn alr. Kabuk tabakas hakknda, manto ve ekirdek ta bakalarna gre ok daha fazla bilgiye sahibiz. Manto ile kabuk arasnda srekli bir etkileim bulunur. Manto taba kasndaki erimi scak kaya yavaa yukar doru hareket ederken, yzeye yakn yerde bulunan daha souk kaya ise aa doru batar. Bunun nedeni scak materyalin daha hafif olmasdr. Scak ve souk materyalin bu ekilde yer deitirmesine evrim ad verilir. M anto yavaa hareket ederken kabuk tabakasn birok geni boumlar halinde krar. Bu tabakalara tektonik tabakalar ad verilir. M anto nun hareketi sonucu kabukta ktalar hareket edecek, da lar, volkanlar ve depremler oluacaktr. (izelge 1)

Ay oluumu: Dev arpma teorisi


Ayn sahip olduu baz zellikler, bize nasl olum u olabilecei hakknda fikir verm ektedir. lk olarak, youn luunun dk olm as, Ayn m erkezde byk bir m etalik ekirdek ierm edii anlam na geliyor olabilir. G erekten de, Aydaki yerekim i Dnyadakinin altda biri kadar dr. yapsna baktm zda ise, genel olarak Dnyanm m anto ve kabuk tabakalarnn yapsna benzer olduunu grrz. Ancak Dnyanm ekirdek yapsna benzem e m ektedir. Bu tr verilerin bizi gtrd bilim sel teori dev arpm a (giant im pact) teorisidir. Bu teori, Ayn oluum uyla ilgili olarak bilim insanlarnca en geni ka bul gren teoridir. Bu teoriye gre, Dnyanm olum as srasnda M ars byklndeki bir gkcism i Dnyaya arpm ve Ay oluturacak kadar yeterli maddeyi uzaya sam tr. Sonu olarak da, Dnyaya arpan gkcism iyle birlikte arpm a sonucu Dnyadan salan paralarn bir araya gelm esi ve Dnya evresinde yrngeye yerlem e siyle Ay olum utur. arpan gk cism in e baz kaynaklarda T h e ia (4) ad verilir; M ars boyutlarna yakn b y klkte olduu tah m in ed ilm ektedir. G ne Sistem iyle b irlik te olumaya balam b ir gezegen olabilir ve yksek ihtim alle y r n gesinden karak D nyaya arpm tr. arpm ann yak lak olarak 4 ,5 3 3 m ilyar yl nce olduu tahm in ed il m ektedir.
4 ) T h e ia : Y u n a n m ito lo jis in d e a y d n lk ta n so ru m lu ta n ra d r.

izelge 1. D nya'nn i yapsnn temel zellikleri.


Younluk (f^Vr K aln lk (k m ) K abuk 30 Um 2 ,2 2 ,9 st M a n to 720 3 .4 4 ,4 A lt M a n to 2171 4 .4 5 ,6 D e k ir d e l 2259 9 ,9 1 2 ,2 e k ird e k 1121 1 2 ,8 1 3 ,1 D e m ir -1 o k s i e n , k k K , k l a la lm . D e m ir + o k s ije n , k k r t , n ikel a la m . A lt K a y a tip i S ilis ik k a y a . A d e /.il, tu b a n d a l a /u l t. P e r id o ti t , e k l o j il , o liv in , s p in e l, lal, p i r o k s e n . P e o v s k i l , o k s i l e . [M a g n e z y u m v e s ilik o n o k s itle r . 1

102

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

103

arpm ann nasl ger ekletiini anlam ak ama cyla hazrlanan bilgisayar simlasyon modelleri bu byklkteki bir gkcis minin dk a ve h z da Dnyaya arpmasyla manto tabakasndan ok miktarda m ateryali savu rarak Dnyadan uzak ekil 5 5 . Genesis ta, A poilo 15 latrm olabileceini greviyle A y'dan getirilen kaya gsteriyor. Bu m ateryalin rneklerinden biridir. byk ksm Dnyanm yrngesinde kalm ve zaman iinde de Ay oluturm u tur. Ancak arpan gkcism inin m etalik ekirdek yaps Dnyanm m antosuna gm lerek Dnyanm ekirdeiyle birleecektir. Bu m odel Ayn neden m etalik bir ekirdee sahip olmadm aklayabilecek bir modeldir. arpm a nn, Dnyanm olumaya balamasndan 10 m ilyon yl kadar sonra olm as, Dnyanm ekirdeinin byk oran da deimeden kalm asn ekil 56. Mars byklnde bir salam olmaldr. gkcism inin Dnya'ya arpmas Benzer arpm alarn sonucu uzaya yaylan paralar zaman ierisinde D nya'nn yrngesinde birok gezegen iin m ey
dolanan A y' oluturdular.

denin ne kadarnn Ay olu turduu vardr. (ekil 56) Ayn y aam z erin e e tk ile ri Ayn olum asna neden olan dev arpm a sonucun da ortaya kan devasa enerji Dnyanm ve Ayn tmyle erim esine neden olm utur. M anto tabakas buharlam ve tekrar younlam tr. Y zey b ir magma okyanusuyla dolm utur. lk atm osfer taba kas da yok olm u olmaldr.

ekil 5 7 . D nya'nn 2 3 ,5 'lik


eksen deiiklii sayesinde farkl mevsimler ortaya kmtr.

arpm ann canllk asndan en nem li etkilerinden biri, Dnyanm ekseninde m eyda na gelen 2 3,5 derecelik deime ve devamnda da Ay ile Dnya arasnda kurulan dengedir. Eksendeki bu nem li deiiklik, canllk iin hayati nem tayan mevsimlerin olum asn salamtr. (ekil 57) Eer Ay var olmasayd, sadece onlarca m ilyon yllk bir zaman ierisinde Dnyann eiklii byk deiiklikler geirebilirdi. Bu da sonu olarak Dnyann iklim ine b yk zararlar verecek ve karasal yaamn gelim esini yk sek ihtim alle engelleyecekti. Ayn Dnya zerine dier bir etkisi de, gelgitlerdir. Dnya zerindeki gelgitlerin byk ksm , Ayn ekim kuvvetinin etkisiyle olum aktadr. Bir m iktar da G nein ekim kuvvetinin etkisi bulunur. Gelgit etkisini net ola rak, alalan ve ykselen deniz seviyesinde grebiliriz. Yeryz de sular kadar olmasa da Ayn ekim inden etki lenir. Ayn yaknlna bal olarak belirli blgelerde 1-2 cm ykselip alalabilir. (ekil 58) Ay olutuundan beri, gelgit srtnm esi sayesinde, Dnyann kendi evresinde dnme hzn yavalatmaya devam etm ektedir. Byk ihtim alle Dnyann ilk za manlarnda dnm e hz daha fazlayd ve daha ksa gn ler yaanyordu. Dier yandan Dnyanm ilk bataki hzl

dana geldii dnl m ektedir. Dev arpm a y sim le eden bilgisayar m odelleri Dnya ve Ay sistem inin yksek asal m om entum unu ve Ay e kirdeinin kkln aklayabilm ektedir. Bu teoriyle ilgili yam tlanam am sorular arasnda, D nyann arpm a n ce si ktlesi, arpan gkcis m inin greceli boyutlar ile bunlardan kan mad-

104

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

105

dnnn nedenlerinden birisi de Ayn da olutuu dev arpm a olaydr. Ayn oluum unun dier bir etkisi de, dev arpm a sonrasnda ilenebilir m e tal kaynaklarnn yzeye yakn yerlere dalmasdr. arpma olmasayd, bu tr m etallerin ou Dnyann

ekil 58. Fotorafta Derby


Kasabas'nda g e lg it ncesi ve sonras grlmektedir. Avustralya'nn kuzeybatsnda bulunan Derby Kasabas, en byk gelgitlerin gerekletii yerlerden biridir.

ekirdeinde toplanacakt ve sonu olarak tekn olojik gelime byk ihtim alle engellenecekti. G eceleri avlanan canllar da Ayn safhala rna gre hayatlarn dzenlerler. D olunay zaman avcla rn avlarn rahata grm elerini salar. Baz bitki trleri de sadece Ay varken ieklerin i aar. Dier zamanlara oranla dolunay zamanlarnda daha fazla hayvan doum yapar. M atem atiksel hesaplamalarda, zellikle astronom ide, Dnya ve dier gezegenlerin tem el zelliklerinin (ktle, ap, evre vb.) hesaplanm alarnda, Ay bir lek olarak kullanlm tr. Sanatsal rnlerde de daima bir esin kay na olm u, insann kltrel yaam nn geliim inde rol oynam tr.

bulutu ierisinde var olan suyun zamanla aa km as dr. Birikm e srasnda ve devamnda yzeye arpan ve su ieren m eteorlarla da tanm olabilir. Dier bir yol olarak da younlukla buz yapda olan kuyrukluyldzlarn (ilkel gezegenler) Dnyaya arpm alaryla tanm olabilir. Bu ihtim alleri bir araya getirdiim izde okyanuslarn balang cn gnmzden yaklak 4 ,5 m ilyar yl nce Dnyann olumaya balad zamana kadar geri gtrebiliriz. Daha n et bilgi sahibi olabilm ek iin ilk yaplmas ge reken ey, elim izdeki su rneklerini incelem ek olacaktr. Suyun ierii bize bir fikir verebilir. Kuyrukluyldzlar: imdiye kadar bilim insanlar Halley ve Hyakutake gibi kuyrukluyldzlarda bulunan su yaps n inceleyebildi. Eer Dnyanm oluumu srasnda arpan tm kuyrukluyldzlar benzer eit buz ieriyorsa, okya nuslarn tek kayna olarak kuyrukluyldzlar gstereme yiz demektir. Bunun nedeni kuyrukluyldzlarda bulunan buzlardaki dtoryum (hidrojenin izotopu(5)) m iktarnn okyanus suyundakinden iki kat fazla olmasdr. Bu bize tek kaynan kuyrukluyldzlar olamayacan gsteriyor. M eteorlar: Dier bir kaynak ise Dnyaya den m ete orlardr. A ncak okyanuslarn tek kayna olarak m eteor lar da gsterm ek doru olm ayacaktr. Bunun nedeni ise, suyun tek kayna m eteorlar olsayd atm osferde im di olduundan 10 kat daha fazla zenon (soygazlardan biri) olm as gerektiidir. M eteorlar fazla m iktardaki zenon ga zn Dnyaya tar. Dnyanm yapsnda hapsedilm i su: M eteor ve kuy rukluyldzlarla taman su dnda Dnyann oluumu (birikim ) esnasnda yapsnda hapsedilmi su da bulu nur. Zenon ve dtoryum sorular da bu ekilde alabilir. Dnyanm oluumu ncesinde tem eli oluturan kayasal maddeler, solar nebuladan (Gnei de oluturan toz ve gaz bulutu) su ieren paralar da yapsna katm olmaldr. Dnyann oluum srecinde ise kat halde hapsedilmi

I Suyun I kayna nedir?


O kyanuslarn kayna ned ir? sorusu bizi doal olarak Suyun kayna ned ir? sorusuna getiriyor. Dnyadaki su, farkl kaynaktan gelm i olabilir. Birincisi, hareket halindeki Dnya m anto tabakasndan (en stteki kabuk tabakasnn bir alt tabakas) gaz olarak atm osfere verilmi ve sonra da younlaarak yamur olarak yzeye gelmi olabilir. Bunun anlam da Dnya oluurken biriken toz

5 ) z o to p : A to m n u m a ra s ay n , k tle n u m a ra s fa rk l a to m la r b ir b irin in iz o to p u d u r. D i e r b ir d e y ile p ro to n s a y la r a y n , n tro n sa y la r fa rk ld r.

106

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

107

uucu m olekller (elementler, bileikler, su vb.) yksek s caklk nedeniyle atmosfere salmmtr. Bu yzden, Dnya, okyanuslar ve atmosfer birlikte olumutur denebilir.

X . T 1I nasl olutu?
Tm bilgilerim izi bir araya getirdiimizde okyanusla rn olum asn drt basam akta zetleyebiliriz: lk dnem, Dnyanm birikm eye balad 4 ,5 6 milyar yl n cesin den, ekirdein ayrld ve i ksm dan gaz knn b it tii 4 ,4 5 -4 ,5 0 milyar yl ncesine kadar geen zamandr. Bu dnemde karbon ierikli kondrit gktalar suyu ve organik molekl Dnyaya tam olmaldr. arpma sonucunda da uucu m olekller atm osfere yaylmtr. Dnyann yzeyi erimi bir haldeydi ve gelen suyun bir ksm da eriyik ierisine karm olmaldr. Bu dnemde Dnyaya taman su m iktar gnmz okyanuslarndan
ekil 59. O kyanuslarn oluumunda
birinci aama. 4 ,5 milyar yl nce meydana gelen ve A y' meydana getiren dev arpma ise (bkz. 22. soru) scakl yaklak 2 0 0 0 C'ye ykselterek Dnya yzeyinin erimesine neder olmutur. Bu dnem de var olan su da silikayla birlikte buharlam olmaldr.

I kyanusiar

zam anm ise 4 ,5 0 -4 ,4 5 milyar yl ncesi olarak gsterebiliriz. Dev arp ma sonucu oluan youn atm osfer hzlca younla arak birka binyl ieri sinde yzeye geri dnm tr. Geride kalan atm osfer ise temel olarak su buhar ve C O z ieriyordu. At m osferde bulunan yksek ekil 60. Okyanuslarn oluumunda ikinci aam a; 4,5 m ilyar yl nce H 0 - C 0 2 m iktar nedeniy- ( 2,5 milyon yl), youn sera etkisi le oluan kon trol d sera ve kabuk oluumu. Yzey scakl etkisi, okyanuslarn olu 1 0 0 0 C . m asndaki ik in ci dnem dir. Bu sera etkisi, Dnyann i ksm ndan s ak devam ederken yzeyin de erim e scaklnda kalm asnda etkili olm utur. Birka m ilyon yl ierisinde yzey 1000 C ye kadar souyarak bazalt bir yapnn olum asna olanak salam tr. Bylece atm osfer ile Dnyann scak i ksm arasnda bir set ekilm i oldu. Yzeyin soumaya devam etm esi, suyun da younlam asn salad. (ekil 60) O kyanuslarn olum asn ise dnya apnda yaanan byk bir sel halini alan suyun younlam as olay sa lad. Bu da nc dnem ekil 61. Okyanuslarn saylabilir. Byk ihtim alle oluum unda nc aam a; 4 ,4 0 de youn yamurlar n e 4 ,2 6 milyar yl nce, binyldan uzun bit srede youn ya, okyanuslarn deniyle binyldan ksa bir ortaya k. Yzey scakl 3 0 0 C. srede okyanuslar ortaya kt. Gnm zdeki ya m iktarnn on kat fazlasnn dt tahmin ediliyor. (ekil 61) Dnyann olumasndan 5 0 -1 5 0 m ilyon yl sonra scakln 3 0 0 C ye kadar dt sylenebilir. A n cak bu scaklk yaamn

ok daha fazladr, ancak gl UV nlar nede niyle su buharlaarak kaybedilm itir. 4,5 milyar yl nce meydana gelen ve Ay' meydana getiren dev ar pma ise (bkz. 22. soru) scakl yaklak 2 0 0 0 C ye ykselterek Dnya yzeyinin erim esine ne den olm utur. Bu dnem de var olan su da silika ile birlikte buharlam o l maldr. (Sekil 5 9 ) ya O kyanuslarn orta knda balang

i
i

108

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

109

balayabilecei bir scaklk olm aktan ok uzak. Sera etkisi sayesinde okyanus lardaki scaklk zamanla bir dengeye ulam olm a ldr. Okyanus dibinin karbonlanm as C 0 2nin
ekil 62. O kyanuslarn oluum unda
drdnc aam a; 4 ,2 6 -3 ,9 0 milyar yl nce, yaanabilir okyanuslarn ortaya k. Yzey scakl 5 5 -1 0 5 C.

atm osferden ekilm esinde

nem li rol oynad. Dipte oluan karbonat da Dnyam n daha yapi. , ,

sna doru karyordu. Bir tr geri dnm ya anyordu denebilir. O kyanus kabuunun oluturulup yenilenm esi Hadean D nem inde daha yksekti. Bunun nedeni de Dnyann i yapsnda bulunan s fazlasyd. M antoda meydana gelen iddetli s yaym okyanus kabu unu ekillendiriyordu. 3 0 -1 6 0 m ilyon yl ierisinde at m osferik C 0 2nin nem li m iktan kabuk yapsna katlm olm aldr. Bunun anlam da gnm zden 4 ,3 -4 ,2 milyar yl nce okyanuslar kararl bir hale gem iler ve yaa m n balayabilecei kadar da soumulard. Bu zaman ve devam da drdnc dnem olarak kabul edilebilir. Bu dnem de asteroit ve kuyrukluyldz arpm alar devam et tiinden blgesel olarak scaklk artm olm al, ancak Ha dean D nem i sonunda (3 ,9 milyar yl nce) m eteor bom bardm annn bitm esiyle de okyanuslar tam olarak kararl hale gem itir. (ekil 62)

etkili olm utur. Kta hareketleri, s ak, gaz ve buhar alverii ya da canllarn ortaya sald kim yasallar gibi Dnya iinden etkiler olduu gibi, G nein parlakln daki art, Dnyann yrngesindeki kadem eli deiik likler ya da nadiren de olsa devasa m eteor arpm alar gibi Dnya d etkiler de sz konusudur. Dnyann ilk zamanlaryla ilgili bilgilerim izi temelde kaynaktan alyoruz. Yaklak 3 ,5 milyar yl ncesinden kalan je o lo jik rneklerden, atm osferin deiim ini tahmin eden sim lasyon program larndan ve Dnyaya yakn di er gezegenlerle yaptmz karlatrm alardan. ilk atm osfer yapsnda h id ro jen ve helyum ieriy or olabilir. Bu tr h a fif gazlar, D nyan n ekim gc ye terin ce kuvvetli olm adndan ve gne rzgrlarn en gelleyecek ekild e dnyann m anyetik alan geli m ediinden yzeyde kalm ak yerin e uzaya kayordu. ek ird ek yaps b elirli hale g elin ce ve devam nda da m an yetik alan o lu un ca, gazlar D nya yzeyinde tu tu labilm eye balad. M anto tabakasnd aki ar h a re k e tli lik de durulm utu. Belirli dnem lerde Dnya yzeyine arpan byk gk cisim leri de uzaya gaz salnm asna neden olm utur. Ay meydana getiren dev arpm a ise son derece iddetlidir ve Dnyay ateten bir top haline getirerek olas tm at m osferi uurm utur. lk k alc atm osfer ise Dnya olu urken yapya k a tl m gezegensi gkcisim lerin in yapsndaki u ucu gazla rn volkanik aktiv itelerle dar salnm asyla olum utur. A ncak bu atm osfer silika buharlam as nedeniyle o k daha youn b ir yapdayd ve karb o n d io ksit baskn olan gazd. B unun dnda azot gaz, su buhar, az m iktarda karb o nm on o k sit ve o k az m iktarda da m etan ve h id ro je n bulunuyordu. K arbon d ioksitin younluu sera etkisi yaratyordu ve G nein parlakl az olsa da, Dnya y zeyi sera etkisi sayesinde scak kalabiliyordu. En azn dan ilk onlarca m ilyon yl ierisind e, D nyada ok ak tif b ir volkanik aktivite m evcuttu. M anto tabakas ile yzey arasnda u ucu m addeler s rek li olarak yer deitirdi.

I Atmosfer I nasl olutu?


Balangcndan itibaren birok faktr, atm osferin olu m asnda ve gnm zdeki haline kadar deimesinde

110

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM ve DNYA

111

Dierleri %1 (% 0,09 argon %0,03 karbon dioksit)

Silikan n km esiy le birlikte yzeyde kabuk tabakas da olum aya balad. Bu dnem de atm osfer te m el olarak su buhar ve k arbond ioksitten oluuyordu. Daha sonralar ise atm osferdeki youn karbondioksit manto tabakasnda geri d

S Am O

Dnya zerindeki ktalar nasl olumutur ve zaman iinde nasl deimitir?

ekil 63. G nm z atm osferinin ierii.

nm e urad. Su buhar ise youn yamurlarla yzeye tanarak okyanuslar oluturdu. lk atm osferlerin yapsnda serbest halde oksijen bulunm uyordu. Serbest halde o labilecek tm oksijen atom lar, h id ro jen ya da yzeydeki m ineraller tarafn dan balanm t. Buna bal olarak UV n larn n za rarl etkisine kar kalkan grevi gren ozon tabakas da gelim em iti. Devam eden m ilyarlarca yl ierisind e, D nyann biyosfer ve atm osfer tabakalar beraber ev rild ike, fotosen tezin yan rnleri, zellikle de serbest o k sijen , atm osferin yapsn deitirm eye balad. K o ruyucu bir ozon tabakasnn da olum asnda fotosentez sonucu oluan o k sijen in rol byk olm utur. O zon ta bak asn n oluum unu anlattm z soruda daha detayl olarak serbest o k sijen in ozon tabakasnn olu m asnd a ki rol nd en ve devam nda da can llk zerindeki etk ile rinden bahsedeceiz. G nm z atm osferinin kim yasal yapsna da ksaca bakacak olursak; azot (yzde 7 8 ), oksijen (yzde 21) , argon (yzde 0 ,0 9 ), karbondioksit (yzde 0 ,0 3 ) ve di er eitli gazlar bulunur. Su buhar da bunlardan biridir. O ksijen orannn artyla birlikte, ckl creli organizm a lardan binlerce kat byklkte, devasa boyutlardaki hay vanlarn olum asnn n alm tr. O ksijen, bu devasa hayvanlarn kullanabilecekleri hazr enerjiyi salam tr. (ekil 63)

Dnya zerindeki karalarn nasl ekillendii ve g nm zdeki ktalarn nasl evrildiklerini en iyi aklayan teori levha tektonii teorisidir. Bu teorinin balangc Alman jeo fiziki Alfred W egenerin 1 9 1 2 de ne srd ve 1 9 1 5 de de K talarn ve O kyan uslarn K ayn a adl ese rinde gelitirdii ktalarn kaym as teorisidir. Teorinin kurulm asna giden yol basit bir gzlemle ba lyor. Dnya zerindeki ktalarn ekillerine bakldnda, bir yapbozun birbirinden ayrlm paralar gibi duruyor lar. rnein, Amerika Ktasn Afrika ve Avrupaya b iti tirdiinizde yapboz paralar gibi uyum salyorlar. Ben zer ekilde Afrikann gney ucu ile Antartika, Avustralya, Hindistan ve Madagaskar da uyum iindeler. (ekil 64) Ktalarn snrlar arasndaki bu uyumu ilk fark eden W egener deildi. M agellan ve dier kifler de hazrla dklar haritalarda bu uyumu fark etmilerdi. Ancak W e gener, Dnya yzeyinin zamanla deitiini ve belki de gem ite bir zamanda tek bir kta halinde olduunu fark eden ilk kiiydi. Bu gzlemle uyumlu olan nemli bir bulu ise fosil kaynaklarndan geldi. Paleontologlar birbirlerinden ok
ekil 64. Dnya haritasna baktm zda, ktalarn ekilleri bir yapbozun
parasym gibi birbirine uyum gsteriyor.

112

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

113

uzakta bulunan ktalarn birbirlerine bakan sn r blgele rinde ok benzer trlerin fosillerine rastlad. O kyanusun farkl kylarnda (G ney Am erika ve Afrika kylarnda) benzer bitki ve hayvan fosilleri ortaya karlm t. Dnyanm gem i zam anlardaki iklim yaps zerine alan aratrm aclar da dnya zerinde buzullarla kapl o k geni karasal alanlarn im di birbirlerinden o k uzak ta olduklarn gzlemledi, ite bu ve benzeri gzlem ler dnya litosferinin (tayuvarlak ya da karalarn) zaman ierisinde hareket halinde olduu fikrini destekliyordu. W egenerin dnem inde fikirleri tartm a yaratyordu; nk W egener bir gzlem i ortaya koyarken nedenini aklayam yordu. Ktalar hareket ediyordu, ama ileyi m ekanizm as neydi? O dnem deki bilim insanlarnn ge nel fikri Dnyanm snm a ve souma dngleri sayesinde bugnk eklini ald ve ktalarn da sabit olduuydu. Yatay bir hareket yerine dikey bir hareket olabilirdi. W egenerin ktalarn kaym as teorisi kta hareketleri ni aklayam asa da, kabuk tabakasnn hareket ettii fikri ni bilim dnyasnda ilk defa ortaya koym u ve daha sonra gelitirilecek olan levha tektonii teorisine de nayak olm utur. (ekil 65 )
e k il 6 6 . Dnya zerindeki yedi byk levha birbirlerine gre

hareket halindedir. O k la r ktalarn hareket ynlerini gsteriyor. Sada ise, Kuzey Am erika Levhas ile Pasifik Levhas arasndaki San Andreas snr kr grnyor.

fer tabakas tektonik levha ad verilen tabakalar halinde blnm durumdadr. Tem el olarak yedi byk levha ve o k sayda da daha k k levha bulunur. Bu tabakalar astenosfer ad verilen bir alt tabakann zerinde birbirleriyle etkileim halinde hareket eder. Ktalar Dnyanm m anto tabakasnn zerinde yzm ekte olan ite bu devasa levha lar zerinde hareket ederler. T ek to n ik levhalarn hareket edebilm esinin nedeni, litosferin altta bulunan astenosfer tabakasna oranla daha sert ve daha az youn olm asdr. H areketi salayan m ekanizm ann tem elinde ise Dnyanm daha alt tabakas olan m anto tabakasndan yaylan s b u lunur. Dnyanm ekirdeinde gerekleen radyoaktif reaksiyonlar m anto tabakasnn snm asna neden olur. Isnan gazn ykselm esi st tarafta bulunan levhalarn da hareketini salar. (ekil 6 6 ) D eprem ler, volkanik aktiviteler, da oluum lar ve okyanus dibi yarklarnn oluum u, bu levhalarn birbirlerleriyle olan snrlarnda meydana gelir. Levhalarn b ir birlerinden uzaklam alar ylda ortalam a 0 -1 0 0 mm ara sndadr. ok ksa b ir m esafe olsa da m ilyonlarca yllk bir zaman iinde yzlerce km ayrm oluabilir. (ekil 67) zellikle 2 0 . yzyln ik in ci yarsnda yaanan tek n o lo jik gelim eler ve elde edilen yeni bulgular levha tekto nii teorisini desteklem itir. rnein, D nyan m gem i zam anlardaki m anyetik alann aratran alm alar, man-

Levha tektonii teorisi nedir?


Levha tektonii teorisi Dnyanm litosfer tabakasnm n (st kabuk tabakas) nasl hareket ettiini anlatr. Litos e k il 6 5 . Alfred W egener (solda), birbirinden binlerce kilom etre uzaktaki

ktalarda bile ayn hayvan ve bitki fosillerinin bulunduunu fark etmiti.

jslrosaurus irungeninln fosil kalntlar X LYA


soptem

(ereltotu)

C y n o g m lC ^
srngeninin fosil kalntlar

kalnhlar ^ SstoSors (latlsu srngeni)

114

50 SORUDA YAAMIN TARH

Y K R /G N E SSTEM

ve D N YA 115

K ta la rn e k ille n m e s i K talar byk ih ti m alle en az 2 m ilyar


225 my 200 my

yld r h areket halinde. A ncak jeo lo g la rn sa hip olduu tarih n cesi kayalarn ou en faz la 8 0 0 m ilyon yllk. Daha n cek i zam an

150 my

65 my

dan k alm olan okya nus kabuunu n byk k sm ise m anto taba k asn a geri dnm durum da. Jeologlara gre yak lak 8 0 0 my ktalar tekrar b ir araya gele

ekil 67. Levhalar farkl yollarla birbiriyle etkileime girer ve hareket


ederler. Deprem ve volkanik aktiviteyle birbirinden ayrlabilirler (sol st), iki levha arptnda biri bklerek dierinin altna ynelebilir (sa st), kta tayan iki levha arptnda da sralar ykselebilir (sol alt) ya da levhalar birbirinden farkl ynlerde kayarak hareket edebilir (sa alt).

Buan

yetik kuzey kutbunun zaman ierisinde hareket halinde olduunu gsteriyor. Bunun anlam kuzey kutbunun ya da levhalarn hareket halinde olduudur. Kuzey kutbu te mel olarak sabit kaldndan, bu sonular levha tektonii fikrini destekliyor. Benzer ekilde, 1 9 6 0 l yllarda n kle er aratrm alar iin Dnyann birok yerine yerletirilen sism om etreler (yerdeki titreim leri ve zellikle deprem le ri tespit ediyorlar-deprem ler), deprem lerin, volkanlarn ve dier aktif je o lo jik zelliklerin dnya zerinde belirli kuaklar boyunca yer aldn ortaya kard. Bu kuaklar tektonik tabakalarn (levhalarn) kenarlar olarak tanm land. Dnya tarihinde k talar arasndaki arpm alar so n ucu s perktalar olum u ve tekrar paralanm tr. S perktalarn paralara ayrlm as ile oluan krklara Dnyan n m anto tabakasndan gelen m ateryal dolarak yeni b ir okyanus kabuu oluturm utur. Ktalar b irb i rinden ayrldka da yeni b ir okyanus taban gelim itir. Dnya yzeyinin te b iri ktasal kabukla kapldr, bu yzden ktalar ayr olsalar da birbirleriyle arprlar, ik i kta arptnda arada bu lu nan okyanus taban yok edilir.

ekil 6 8 . Son sperkta Pangea'dan


gnmze ktalarn deiimi.

rek Rodinia ad verilen sperktay oluturdu. im di Ku zey Am erikann bulunduu yer Rodinianm merkeziydi. Dnyann m anto tabakasndan yzeye gelen materyal ile birlikte Rodinia paralara ayrlmaya balad ve bu paralar da 5 0 0 ve 2 5 0 m ilyon yl nce tekrar arpt. S o n s p e rk ta G nm zden 2 5 0 m ilyon yl n ce, ayr ktalar te k rar b ir araya gelerek Pangea ad verilen son sperktay oluturdu. Pangeay evreleyen denize ise Pantalassa ad verilir. Pangea zam an ierisin d e kuzeyde Laurisia ve gneyde de G ondvana ad v erilen ik i kara parasna ayrld. Arada bu lu nan denize ise T etis ad verilir. Levha h areketleri sonucu zam anla bu kara p aralar da b l n erek bugnk k talar olu tu rd ular. G ondvana b l nerek Afrika, A ntartika, Avustralya ve G ney A m erika k talarn ve H indistan alt k tasn oluturd u. Laurasia da b l n erek Avrasya ve Kuzey A m erikay m eydana ge tirdi. (ek il 6 8 )

116

50 SORUDA YAAMIN TARH

Y K R /G N E SSTEM v e DNYA

117

Levha hareketlerinin canllk zerine etkileri


Ktalarn konum lar Dnyam n iklim ini, deniz seviyesi ni, canllarn dalm n ve yeni trlerin ortaya km asn ya da yok olularm etkileyecektir. rnein 5 0 0 m ilyon yl nce Gondvana Sperktas gney kutbu zerinde olutuunda Dnya bir buzul ama girdi. Suyun byk oranda buzullarda hapsedilm esiyle deniz seviyesinde de d grld. Deniz seviyesi dtke de ktalarn deniz altnda kalan ksm lar yzeye km oldu. Bu blgelerde gelimi olan canllar da ya ld, ya adapte oldu ya da baka blgelere g etti. Ktalar birbirleriyle arptklarnda ayr ktalarda b u lunan trler birbirin e kartlar. K talar tekrar ayrldkla rnda da yeni trler dier ktalara gem i oldu. rnein, Afrika, G ney Am erika, Avustralya ve Yeni Zelanda bir zam anlar var olm u Gondvana isim li s perktan m par alanm asyla olutu. n ce Afrika, sonra Y eni Zelanda ve son olarak da Avustralya ve G ney A m erika ana ktadan koparak ayrldlar. Tm bu ktalarda bulunan baz tr lerin evrim sel yaknlna bakarak k talarn birbirind en hangi srayla ayrldn anlayabiliriz. K k bir b cek olan tatarck trnn farkl ktalarda bu lu nan rnekleri incelendiinde, G ney Am erika ve Avustralyada b u lu nan t rlerin birbirin e Yeni Zelandada bulunan rn ek lere gre daha ok ben zerlik gsterdii ortaya kyor. Benzer ekilde ktadaki rnekler ilk ayrlan k ta olan A frikada bulunan rneklerden daha fazla ben zerlik gs teriyor. Madagaskar gnmzde Afrikann gney ucuna yakn bir blgede bulunan bir adadr. Adada bulunan hayvanlar H indistanda bulunan hayvanlarla byk benzerlik gs term ektedir. H indistan ile M adagaskar arasndaki mesafe karasal trlerin ulaamaya kadar byktr (4 0 0 0 km ). Bir zam anlar bir arada olan Madagaskar ve Hindistan, yaklak 100 m ilyon yl kadar nce birbirlerinden ayrl m tr.

" T I Dnya'nn geirdii JL / I jeolojik devirler nelerdir?


Dnyann ve zerindeki yaam n zaman ierisinde na sl ekillendiini ve hangi aamalardan geerek gnm ze ulatm kavrayabilm ek iin Dnyann geirdii je o lo jik devirlerin zelliklerini bilm em iz bize ok yardm c olacaktr. Bu devirlerin balang ve biti noktalar nem li je o lo jik olaylara gre belirlenm itir ve her devir canllk asndan farkl zellikler ierir. nsanolu ise milyarlarca yl sren bu hikyenin sadece son 6-7 m ilyon senesinde yer alm tr. Elinizdeki kitapta, bundan sonraki bl m ler de yer alan sorularda, yaamn ortaya k ve canlln eitlenm esini ayrntl olarak ele alacaz; fakat bu soru da, canlln hikyesini kavramamzda yardm c olmas bakm ndan, Dnyann oluum dan itibaren geen je o lo jik devirleri, biyolojik evrimle paralel bir btn olarak zet bir biim de veriyoruz. Je o lo jik zamanlar, temelde Kam briyen ncesi ve so n ras olarak ikiye ayrabiliriz. Kam briyen Devrinin (5 4 5 4 9 5 my) ayrc zellii, daha n ceki zamana gre canl eitliliinde yaanan hzl arttr. Yaam her yan dol durmu ve saysz ekil ve trde canl trem itir. En azn dan elim ize geen fosil ve bilgi says bu dnem de byk b ir art gsterm ektedir.

Kambriyen Devri ncesi: Hadean, Arkean, Proterozoyik


Kam briyen ncesinde Dnya yzeyi soum u, atm os fer ve okyanuslar ortaya km t. Yaam gnmzden 3 ,5 -3 ,8 milyar yl nce ortaya km , bakteriler, karyotlar, okhcreli canllar tremiti. Bu dnem h akk n da bilgilerim iz olduka snrl. zellikle ilk zamanlardan gnm ze ulaan kayalarm bulunm am as nedeniyle b il diklerim iz tartm al. Bilinen en eski kayalar 3 ,8 -4 milyar yl ncesine ait. Kam briyen ncesi dnem i kendi iinde farkl zam a na blebiliriz:

118

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM v e DNYA

119

1)

H adean

Eou

(-4 5 0 0 -3 8 0 0 m y): Bu dnem jeo lo jik bir devir olarak kabul edil mese de, Dnya tari hinin btnlnn salanmas asndan zelliklerini bilmeliyiz. ekil 69. H adean D nem i'nde Dnya'y Bu dnem, Dnyamn betimleyen bir izim. ve Gne Sistem inin oluum aamasnda olduu ve Dnya zerinde youn m e teor bom bardm annn yaand dnemdir. Ay oluturan dev arpma da bu dnemde meydana gelmitir. Bu gibi dev arpmalar sayesinde Dnya ilk zamanlarda erimi bir halde olsa da, sonralar yzeyde kabuk tabakas, ilk k talar, atm osfer ve okyanuslar olumaya balamtr. (ekil 69) 2) A rkean Eonu ( - 3 8 0 0 - 2 5 0 0 m y): Bu dnem in belir leyici zellii, yaam n ilk defa Arkean Eonunun banda ortaya kdr. Baskn olarak bulunan canl grubu arkealard ve okyanuslarda yayorlard. Atm osfer gnmz at m osferinden ok farklyd. Byk ihtim alle m etan, am on yak ve dier toksik gazlardan oluan ve darda yaama izin verm eyecek indirgen bir atm osfer vard. Fotosentez yapan siyanobakterilerin ortaya k ile birlikte okya nuslarda oksijen de yaylmaya balad. (ekil 70) 3 ) P ro tero zo y ik E onu ( - 2 5 0 0 - 5 4 5 m y): Dnya ve ya am iin en heyecan verici gelim elerin ou bu dnem de gerekleti. Atm osferde ekil 70. Arkean D nem i'nde o k sijen m iktarnn art
D nya'y betimleyen bir izim.

ekil 71. Proterozoyik Dnem 'in nem li zelliklerinden strom atolitler


(birikmi siyanobakteri fosilleri) ve Ediacara Faunas yaam rnekleri.

byk buzul alar bu dnem de yaand ve yeryznn tam am buzlarla kapland. Bu dnem de Ediacara F au n a s olarak bilin en fauna, ilk yum uak dokulu o k h creli hayvanlar barnd rr. Bu zam anda ortaya kan hayvan lar bilin en canllara benzem eyen garip ekillerd eki ca n l lard. C anl eitliliin in hzla artt bir dnem di. (ekil 71) K a m b riy en D ev ri s o n ra s: F a n e ro z o y ik E o n u ( 5 4 5 m y-g n m z) Bu dnem bizim bildiimiz anlamda grnr yaamn ortaya kt zamandr. Kam briyen Devrinde canl eit liindeki artla balar ve gnmze kadar ulaabilen ok sayda fosil rnei brakr. Suda eitlenen yaam zamanla karalara yaylm ve her yeri kaplam tr. Bu dnem di nozorlardan m em elilere, ilkel bitkilerden devasa orm an lara ve gnm zn iekli bitkilerine kadar ortaya kan trlerle Dnya zerindeki yaam temelden ekillendiren dnem olm utur. 1) Paleozoyik Zam an ( 5 4 5 -2 5 1 ,4 m y): Paleozoyik Zamanm snrlarn yaam asndan ok nem li iki olay belirlem itir. okhcreli hayvanlarn ksa sre ierisinde eitlendii Kam briyen Patlam as ile balar ve tarihte bilinen en byk kitlesel yok olu ile son bulur. Kam b riyen Patlam asn 39. Soruda, kitlesel yok olular da 49. Soruda detayl olarak inceleyeceiz. (ekil 72) Zaman zaman buzul alar yaansa da genel olarak ik lim lman ve nemlidir. Kambriyen Devri banda para lanan sperkta Rodinia kk ktalara ayrlm tr. Bu kt-

ile birlikte arkealar azalarak o ksijen siz b lg ele re ekilirk en bakteriler yayld. Devam nda da karyotlar ve okhcreliler ortaya k tlar. Rodinia S perktas olutu. D nvamn grd en

120

50 SORUDA YAAMIN TARH

YKR/GNE SSTEM

ve DNYA

121

ar karasal iklim M e sozoyik Zam anm ilk dnem inde (Triyas) devam eder. Ju ra da (Jurasik D nem ) iklim yeniden nem li hale ge lir ve ktalar yeniden
ekil 73. Mesozoyik Zam an "dino zorlar
a," olarak da adlandrhr.

bitkilerle kaplanr. Bu
. ,

ekil 72. Kambriyen D nem i'nde sulardaki yaam rnekleri ve sada bir
trllo b it fosili.

talarm en by de Gondvanadr. Paleozoyik Zam anm sonuna doru ise ktalar tekrar birleerek sperkta Pangeay oluturacaktr. Paleozoyik Zamanm ortalarna doru denizlerde om urgallar ve zellikle de balklar yaygnlarken hay vanlar, m antarlar, bitkiler ve bcekler karaya yerlemeye balad. Paleozoyikin sonlarna doru ise yeryz usuz bu caksz orm anlarla kapland. Bu orm anlarda bcekler, am fibiler (suda ve karada yaayanlar) ve srngenler gze arpan hayvanlard. Zamann sonlarnda srngenler olduka eitlendi ve m em elilerin ve dinozorlarn atalar olan gruplar ortaya kt. Paleozoyikin son dnem i olan Perm iyen sonunda ger ekleen kitlesel yok olu ile birlikte canllarnn byk ounluu ortadan kalkt. Ortaya kan biyolojik boluu ise devam eden zamanda zellikle dinozorlar dolduracak tr. 2) M esozoyik Zam an (2 5 1 ,4 m y -65,5 m y): D inozor lar a olarak da adlandrabiliriz. Sperkta Pangea, M e sozoyik Zamanm ilk dnem inin sonuna kadar varln srdrse de, daha sonra paralanmaya balad. Zamann son dnem i olan Kretasede Lavrasya ve Gondvana yeni den birbirinden ayrlr ve daha k k paralara bl nr ler; k talar hemen hem en gnm zdeki biim lerini alm a ya balar. klim scaktr, hatta kutuplarda dahi buzullama yoktur. Paleozoyik Zamanm sonunda balayan kurak ve

nem h Ve mevsim selliin ok belirgin o l mad yum uak iklim sel eilim, Kretase Devri boyunca devam edecektir.

Perm iyen Devri sonunda meydana gelen kitlesel yok oluta sa kalm ay baaran deniz canllar eitlenerek pek ok yeni grup ortaya kard. M odern zam anlarn de niz omurgasz yaam M esozoyikte kurulm utur. lk devir olan Triyasta srngenler ve m em eli benzeri srngenler karasal ekosistem in baskn gruplaryd. lk gerek m em eliler Triyasn sonunda ortaya kt. Triyasm sonunda gerekleen yok olula, m em eli benzeri srn genler de dahil, ilkel srngenlerin ve ikiyaam llarn (am fibiler) ou yok oldu ve yeni dnemde dinozor ve yeni srngen gruplarnn n alm oldu. (ekil 73) Ju ra Devrinde karasal ekosistem in baskn omurgal grubu dinozorlar olurken, timsahlar, kaplumbaalar, ker tenkeleler ve kurbaalar da yayld. Baz srngen grupla r sucul yaama uyum salarken, bir ksm ise um a yete neini kazanarak krallklarn gkyznde kurdular. Ak tohum lu bitkiler, M esozoyikin baskn bitki gru budur. Erken M esozoyikte ereltiler, sikatlar, ginkolar basknken; m odern ak tohum lular, rnein kozalak llar ilk kez gnm zdeki biim leriyle erken Triyasta ortaya kt. M em eliler nem siz bir grup olarak dinozor larn hkim iyeti altnda yaarken, kular da ilk kez Ju ra D evrinde ortaya kt. Son devir olan Kretase sonunda dinozorlar pek ok canl grubuyla birlikte ortadan kalkt. Bu yok oluun yeryzne arpan bir gkcism i nedeniyle olduu yaygn olarak kabul

122

50 SORUDA YAAMIN TARH

Y K R /Y A A M IN ORTAYA IK II

123

6.3. YA A M IN ORTAYA IKII

Q I Dnyada yaam JL O I ne zaman balamtr?


Elde edilen en eski fosil kaynaklar, yaam n dnya zerinde m ilyarlarca yldr var olduunu gsteriyor. Gney Afrika ve Avustralyada bulunan ve stro m ato lit ad verilen tarihncesi fosil kayalar, nem li m ikro fosil kaynaklardr. (ek il 7 5 ) M ikroorganizm alarn st ste katm anlar halinde b irikm esi ile oluan bu kayalardaki fosil rn ek leri, yaam n gnm zden en az 3 ,5 milyar yl n ce var olduunu gsteriyor. Kayalar zerinde, zellikle siyanobakterilerin (m avi-yeil alg olarak da b ilin ir) atalar olduu dnlen hcre fosilleri youn olarak bulunuyor. Yine bu dnemden kalma kayalarda yaplan in cele melerde 3 ,8 milyar yllk biyolojik karbon rneklerinin bulunm as da, canlln ilk ortaya knn bu dneme kadar geriye gidebilecei anlam na geliyor. Yaam n n asl baladnn zlm esi hem heyecan l hem de meydan okuma gerektiren bilim sel bir prob lemdir. imdiye kadar 3 ,5 milyar yldan eski fosil rnei bulunam am tr. Dnyann ilk zam anlarndaki kimyasal ve fiziksel artlarn bilm ediim izden, ilk organizm alarn
ekil 75. Stromatolitler, tekhcreli organizm alar tarafndan tabakalar'
halinde oluturulan kayalardr. Dnya zerinde yaam en eski canl fosilleri bu kayalar zerinde bulunmutur.

ekil 74. Kenozoyik Zam an'n evre artlan ve son zam an devlerinden
mamutlar.

gren fikir olsa da, tartmalar devam etmektedir. Kretase/ Tersiyer yok oluu olarak bilm en bu olayla srngenlerin yz milyonlarca yl sren hkimiyeti sona erdi ve m em eli lerin yaygnlamasn salayacak koullar olutu. 3) K enozoyik Zaman (6 5 ,5 m y-gnm z): Bu dne min temel zellikleri, m em elilerin baskn hale gelm esi, ktalarn gnm zdeki hallerini almas, geni otlaklarn olumas ve son zamanlarnda da insann ortaya karak yaylmasdr. Paleojen, Neojen ve Kuaterner olm ak zere devre ayrlr. Bu zamanda ktalar gnm zdeki konum ve biim le rini yava yava alrken, iklim de gittike kuraklap so udu. Birok buzul a yaand. Kurak ve souk iklim koullar orm anlarn azalmasna yol at. Om urgaszlar, balklar ve srngenler dnem in ban da m odern biim lerine ulat; ancak, m em eliler, kular, bir hcreliler ve iekli bitkiler dnem boyunca evrimleip eitlenm eye devam etti. Tek enekli bitkiler bu zamanda ortaya kp, orm an lardan boalan alanlara yaylarak, ilk kez savan, yayla gibi otlak alanlarn oluturarak memeli evrim inin ana m er kezleri oldu. M em eliler zamann banda san benzeri biim ve boyutlardayken; hzla pek ok garip tarihncesi dev hayvana ve gnmz biim lerine evrinleliler. (ekil 74) Son olarak ise, kendi trmz olan H om o sap ien s son buzul ann sona ermesiyle yaygnlap, ekosistem in baskn canls oldu.

YKR/YAAMIN ORTAYA IKII

125

124

50 SORUDA YAAMIN TARH

deni ise, ilkel Dnya atm osferinde henz ozon tabakas olutuu ortam koullarnn tekrar yaratlm as zordur. Yine de, aratrm aclar kendiliin den oalan organizm alarn na sl olutuunu ve evrimlemeye baladn anlam ak zere h i potezler kurm ular ve bu hipo tezlerin olasln laboratuvar artlarnda test etm ilerdir. Bu hipotezlerin hibiri zerinde genel ortak bir uzlamaya va rlm am sa da, bu tr tem el so rularn zm nde ilerlem eler kaydedilmitir. bulunm adndan, G neten gelen yksek en erjili nla rn canlln atm osferde olum asn byk ihtim alle en gelleyecek oluudur. im di nde gelen hipotezlerden okyanus diplerindeki hidroterm al bacalara gz atalm. Bu bacalarda kim yasalla rn bolluu ve salad enerji, ilk canlln balam as iin uygun ortam oluturm u olabilir. (ekil 7 6 ) Deniz suyu, okyanus dibindeki atlaklardan diplere doru szar ve alt tabaka olan m anto tabakasnn scaklyla stlarak tekrar yukar kar. Deniz tabanndan kan su, o k scak (4 0 0 C ) ve m ineral bakm ndan olduka zengindir. zellikle demir ve slfr daha scak olan siyah duman bacalarn
ekil 76. Okyanus diplerindeki hidroterm al bacalar can llar iin enerji ve zengin mineral kaynadr.

dan salm rken; baryum , kalsiyum ve silikon ise scakl daha dk olan beyaz duman bacalarndan salnr. Bu suyun kaynam aynm nedeni, okyanus dibindeki yk sek basntr. Scak su okyanus tabannn souk suyu ile karlatnda, m ineraller kerek bu bacalar oluturur. Suyun tam k blgesi a n scak olduu halde, evre sine doru daha lm l scaklk kuaklar oluturur. te bacann scak suyu ve okyanusun souk suyu arasndaki lm an blgeler, enerji ve m ineral asndan zengin, ilk hcrelerin ortaya kabilecei dnlen yerlerdir. lk defa 1 9 7 7 de ortaya karlan hidroterm al bacalarn Pasi fik ve Atlantik O kyanuslarnda dier rnekleri de b u lu n m utur. Bacalar evresinde, ksz ortamda, farkl bakteri trlerinden dev boru kurtuuna, midyeden karidese ka dar farkl trler yaam larn srdrm ektedir.

*7 Q I Yaam m y I nerede balad?


Yaygn olan bilim sel gre gre yaam, ilk Dnyanm oksijen ya da oksitleyici dier gazlar bulunm ayan indir gen ortamnda olum utu. norganik m olekllerden orga nik m olekller olutu ve birikti. Karm ak yapdaki biyom olekller de, bu organik m olekllerden olutu. lk hcrelerin byk olaslkla ferm entatif heterotroflar (6) olduu dnlyor. Henz oksijen li solunum ya da fotosentez gelim em iti ve gerekli en erji ortamda bulunan enerji kaynaklarndan salanyordu. Yaam n dnya zerinde nerede ortaya kt sorusu kesin olarak ce v ap lan d rlm asa da, farkl hipotezlerde ne kan yerler arasnda okyanus diplerindeki hidroter mal bacalarn evreleri ya da volkanlarn evrelerindeki ufak su birikintileri bulunuyor. Yaygn olarak kabul edi len fikir ise, yaamn sularda ortaya ktdr. Bunun neS F e r m e n ta tif h e te ro tro fi O k s ije n s iz o rta m d a y aayan , ferm a n ta sy o n y a p a n v e b y m e k i in h azr o rg a n ik k a rb o n t k e te n o rg an izm a la rd r.

30

Yaam iin gerekli nc molekller nelerdir? lksel orba kuram ne sylemektedir?

Dnya zerinde ilk canl organizma birdenbire ortaya km ad. Hcre olumadan nce birok nc adm n g eil

126

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

127

m esi gerekti. Dnyann yaklak 4 ,5 m ilyar yl nce olu tuundan ve canlln da yaklak 3 ,5 -3 ,8 m ilyar yl nce ortaya km olm as gerektiinden bahsetm itik. G rl yor ki, Dnya olutuktan sonra geen 7 0 0 m ilyon-1 m il yar yl kadar sre, canlln olum as iin gerekli uygun koullarn m eydana gelm esini salad. Doa bilim lerinde dnya zerindeki yaam n cansz m addelerden nasl olutuunu anlamaya alan alana kim yasal evrim ya da abiogenesis ad verilir. Abiogenesisin evrim kuram ile kartrlm am as gerekir. Evrim kuram tem el anlamda canllarn zaman iinde nasl de itiini ve eitlendiini anlatrken, abiogenesis cansz m addelerden canl organizmalara geiin nasl olduunu aklam aya alr. Tm can l organizm alar hcrelerden olum utur. H c reler, cansz m olekllerden birdenbire oluam ayacak ka dar karm ak birim lerdir. Dnya zerinde can llk ortaya karken de dorudan hcre yaps deil, baz ara basa m aklar olum u olm aldr. rnein hcre yapsnn tem el talar olan proteinler ya da n kleik asitler de (DNA ve RNA) karm ak yapdadr ve hcre olumadan nce bu gibi karm ak yaplarn olum u olmas gerekir. Bilim insanlar ne srdkleri farkl hipotezlerle hcrenin olu um una kadar giden ara basam aklar anlamaya ve bu ba samaklarda etkili olan kilit m oleklleri ortaya karmaya alyor. ne srlen hipotezlerin hibirine kesin olarak doru diyem esek de, srekli elde edilen yeni kantlar baz hipotezleri dierlerinden ne karyor. Bilim dnyasnda kabul gren ve canlln nasl ortaya ktn anlatan ara basam aklar ksaca yle zetleyebiliriz: B irin ci adm: n celikle, yaam n ortaya kabilm esi iin gerekli evresel ortam olum u olmaldr. Bu yzden ilk adm olarak Dnyam n ve atm osferin olum as d nlebilir. Bu aama yaam n olum as iin gerekli inorga nik ham m addelerin ortaya kt ve birbirleriyle etkilei me getii aamadr. Uygun evre koullarnn olumas baz gezegenleri dierlerinden farkl yapacaktr. Her ge zegende yaam bulunm az, bunun nedenlerine, Soru 14de

yaam iin elverili blgeler konusunda deinm itik. k in ci adm : norganik m olekllerin birbiriyle etkile im leri sonucu organik m olek ller olum aya balam tr. Bu reaksiyonlar iin gerekli olan enerji de yldrm lar, gne ndan gelen m or tesi radyasyon ya da vol kanlardan gelen s enerjisind en elde edilm itir. Yaam n olum asnda rol oynam organik m olekller iki farkl kaynaa sahip olabilir: O rganik m olekller dnya zerinde olum u olabilir. Bunun iin Dnya atm osferindeki en erji kaynaklarndan yararlanlm olabilir (M iller deneyinde -bkz. 3 1. Soruolduu gibi). O rganik m olekller Dnyada olum ak yerine uzaydan Dnyaya gelm i olabilir. Dnyaya arpan gkcisim leriyle (kondritler-tas m eteoritler) tanm ya da Dnyanm ekim kuvveti ile ekilm i de olabilirler. Dnya dnda yaam var m konusunu ele aldmz Soru 15de Gne Sistem i iinde, dnda ve Dnyaya den m eteorlar ze rinde kefedilen karm ak yapdaki organik m olekller den ve hcre benzeri kalntlardan bahsetm itik. nc adm : Dnyada oluan ya da Dnya dndan gelen organik m olekller birikm i, bir araya gelerek daha karm ak yaplar oluturm utur. Bu aamada polipeptid ve nkleik asit gibi hcre ierisinde bulunan karm ak m olekller olum utur. Bu m olekllerden bazlar ilkel can llk zellikleri kazanm lardr. Canlla giden yolda im dilik bu aamaya kadar gele lim. Bundan sonraki sorularda bu adm lar daha detayl ekilde ele alacaz. im di ksaca canlln oluum uyla ilgili fikirlerin nasl gelitiine bakalm . Bu srete birka nem li ism in ne ktn gryoruz. C a n ll n o lu u m u fik irle rin in z e t b ir ta r ih e s i M 4. yzylda yaam A ristotelesin zam anndan 19. yzyln sonlarna kadar geen 2 0 0 0 yl akn zaman b o yunca, bilim insanlar yaam n n asl ortaya kt kon u sunda, kendiliinden rem e (spontaneous generation) kuram n destekledi. A ristotelesin daha nceki bilim in-

128

5 0 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

129

B P S f li
;iy ..v

teinler de daha karm ak d eiikliklerin yolunu am olabilirler. G nm zde byle b ir oluum m m kn o l m ayacaktr, nk cansz m addelerden oluturulan yeni karm ak m olek l h zlca t k etilecektir. Y eni b ir ca n l n n oluum u, ortam da yaayan organizm alar olm ad n da m m kn olm u olm ald r.

ekil 77. En solda Aristoteles (M 384-322), ortada Louis Pasteur (1 8221 895) ve en sada Pasteur'un deneyinde kulland flask tipi.

lksel orba kuram (primordial soup)


Yaam n nasl ortaya km olabilecei konusu zeri ne, Darwin ve Pasteurun zam anndan, Rus bilim ci Ale xander O parinin yeni fikirler ne srd 1 9 2 4 e kadar nem li bir gelim e olm am tr. O parinin gnm zde de geni kabul gren fikirlerine gre: A tm osferik oksijen yaamn olum as iin gerekli organik m olekllerin olu m asn engelleyecektir. Bu yzden cansz maddelerden canl organizm alarn olum as bir kere olm utur, ancak gnmzde bu m m kn deildir. u anki atm osferdeki oksijen ve dier canl organizm alar, cansz m olekllerden oluacak organik m oleklleri tekrar paralayacaktr, ilk dnya ortam im dikinden farklyd. lk dnyann oksi jen siz ortam nda, gne ndan salanan enerji yoluyla organik m olekllerden oluan bir ilksel orba meydana gelm itir. Bu organik m olekller de zaman ierisinde daha karm ak yapdaki koaservat< 7 ) dam lacklar oluturacak lardr. Bu damlalar birbirleriyle birleerek byyecek ve blnerek yeni dam lacklar oluturacaklardr. Bu ekilde de yapnn devamn korum ay am alayan ilkel m etabolik b ir yap gelitireceklerdir. Yapy koruyamayan m olek l ler ise dalacaktr. O parin ile ayn yllarda ngiliz bilim ci J . B. S. Haldane de benzer fikirler ne srm tr. Haldanee gre, Dnyann ilk zam anlarndaki okyanuslarda organik m olekllerin oluabilecei yine ilksel bir orba ortam olum u o lab i lir. Biopoiesis olarak adlandrlan bu fikre gre canllar, kendini oaltabilen cansz maddelerden olumutur. O parin ve Haldane, b irbirlerin d en bam sz olarak
7 ) K o a se rv a t: in d e o rg a n ik m o le k l ( z e llik le lip il) b u lu n d u ra n ve h id ro fo b ik g le b ir arad a tu tu la n k k d a iresel d a m la ck la r.

sanlarnn gzlem ve fikirlerinden yararlanarak olutur duu bu kuram a gre, canl organizm alar cansz organiz m alardan kendiliinden ve birdenbire ortaya kyordu. Bu oluum her zaman her yerde olmaktayd. rnein, bir et parasn birka gn beklettiinizde zerinde grece iniz kurtuklar orada kendiliinden meydana geliyordu. Bu kuram n sonunu getiren alm alar 17. yzyldan iti baren birikm eye balad ve bu kuram a en nem li darbe yi 1 8 5 9 da Fransiz bilim ci Lois Pasteur vurdu. Pasteur, kaynatt et suyunu uzun ve kvrm l bir aza sahip flask ierisine koydu. Kvrm sayesinde dardan ieriye hava giriyordu, ancak partikller ve m ikroorganizm alar gire miyordu. Et suyunda herhangi bir bym e gereklem e di. Ancak flask, m ikroorganizm alarn girebilecei ekilde yatrldnda, et suyu ierisinde hzl bir ekilde bym e gzlem lendi. (ekil 77) K endiliinden t rem e ku ram n n youn olarak tar tld 19. yzylda, Charles Darwin de bu kon u ze rinde fikirlerini belirtm itir. K ukusuz evrim denilince ilk akla gelen isim C harles D arw indir. Burada b elirtil m esi gereken bir nokta var: D arw inin evrim kuram te m el olarak yaamn nasl balad zerine deil, nasl eitlendii zerinedir. Darwin yaam n ilk defa nasl ortaya km o labilecei zerine o k fazla fikir ne s r m em itir. A ncak 1 8 7 1 de ngiliz b o tan ik i Jo se p h D alton H o o k era yazd m ektupta, yaam n ortaya kyla ilg i li u nlar yazm tr: Scak su birikintilerin de am onyak, fosfor tuzlar, k , s, elek trik vb. gibi gerekli bileenler bulunduunda p rotein yaps oluturulm u ve bu pro-

130

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

131

ekil 7 8 . ilk Dnya ortam yaam iin zorlu koullara sahipti. Koruyucu b ir ozon tabakas yoktu ve atm osfer yaps da farklyd. A ncak UV n, yldrm lar ve volkanik patlam alar kimyasal reaksiyonlar iin gerekli enerjiyi salyordu.

ne srdkleri fikirleriyle, kend iliinden trem e k u ra nm n gnm z dnya k o ullarnda geersiz olacan ne srm lerdir. G n m zde, yaam n nasl ortaya k t n anlatan kuram larn h ib irin i kesin olarak doru kabul edem eyiz. Ancak ne srlen kuram lar arasnda bilim insanlar tarafndan en ok kabul gren ve deney sel olarak d esteklenenleri, O parin-H aldane tarafndan ne srlen ilksel o rb a kuram tem eli zerine k u rulm utur.

m ikroorganizm alardr. Bylece organik m olekller birik meye balayacak, younlatka da birbirleriyle etkileim leri artacaktr. O luan yeni m olekllerden bazlar dier lerine gre daha dayankl olacak, daha ok yer tutarak daha fazla zaman var olacaklar ve yaam sal reaksiyonlar gerekletirm eye balayacaklardr. Sonu olarak biriken bu m olekllerin en baarl olanlar kendini kopyalayp oaltabilm e yetenei kazanarak yaam n olum asna gi den adm atacaktr.

*5 " i I Miller deneyi O I I ne anlatyor?


Oparin ve Haldane tarafndan ne srlen ilksel o r b a kuram , ilk balarda ok yaygn kabul grmedi. Bura daki sorun, cansz maddelerden canl m olekllerin olu tuunu gsteren deneysel alm alarn olmayyd. 1 9 5 2 de ikago n iversitesinden doktora rencisi Stanley M iller ve danm an Prof. H arold Urey b ir deney dzenei tasarladlar. A m alar O parin-H aldane h ip o tezinde olduu gibi inorganik m olek llerd en canlln oluum u iin gerekli organik m olek llerin o lu abild i ini gsterm ekti. Bunun iin de ilk atm osferde olduu dnlen k ou llarn aynsn laboratuvar ortam nda canlandrm ay hedeflediler. D eneyin tem el zellikleri unlard: 1) ncelikle ilk atm osferde olduu dnlen indir genmi gaz karm ieriyordu: Karbon kayna olarak metan (C H +), azot kayna olarak am onyak (NH3), o ksi je n kayna olarak su (H O) ve ek olarak da hidrojen gaz (H2) kullanld. 2) lk atm oferdeki yksek enerjili ortam yanstm as iin elektrik enerjisinden elde edilen enerji: lk atm osfer de bu enerji gne enerjisinden, yldrm lardan, Dnyaya arpan m eteorlarn ok dalgalarndan ya da volkanlardan elde ediliyordu.

ndirgen atmosfer ve birikme

Baz bilim insanlar ilk Dnya atm osferinin kim ya sal olarak indirgen (reducing) bir ortam olduunu ne srm ektedir. M etan, am onyak, su, hid rojen slfit, kar bond ioksit ya da karbonm onoksit ve fosfat bulunurken, m olekler oksijen ya da ozon bulunm az ya da ok az m iktardadr. Bu tr indirgen bir ortamda elektrik en erji si yoluyla amino asit gibi baz basit organik m olekllerin olum as katalizlenebilir. Bu durumun olasln ilk ola rak M iller-U rey deneyinde Stanley L. M iller ve Harold C. Urey 1 9 5 3 de gsterm ilerdir. Bu deneyin detaylarna, bir sonraki soruda gireceiz. Byle bir ortamda elektron ve hidrojenler inorganik m ateryali organik yaplara dntrm ek iin hazr bulu nur. G ne enerjisi ve yldrm lar gerekli enerjiyi salaya caktr. (ekil 78) O rganik m olekller olumaya baladk tan sonra birikecektir, nk paralanm alar iin gerekli olan iki etmen ortamda yoktur. B irincisi oksidasyon yo luyla paralanm alar iin gerekli olan oksijen ve dieri ise

132

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

133

3) 0 ile 100 C arasnda evresel scaklk. 4) D eneyin banda salanan steril bir ortam. Deneyin genel gidiat ise u ekildeydi: ncelikle sv haldeki su stlarak su buhar oluturuldu. Elektrodlardan geirilen elektrik akmyla oluturulan kvlcm lar enerji kayna olarak kullanld. Bu ekilde de atm osfer orta m ndaki yldrm larn deney tpnde karl elde edil meye alld. Devamnda da, oluturulan yapay atm os fer soutularak suyun tekrar sv hale gem esi saland. Bylece ilk Dnya ortam ndaki yam urlar deney tpnde canlandrlm oldu. Bir hafta boyunca tekrarlayarak de vam eden deney sonunda sistem e ilk bata eklenen karbo nun yzde 1 0 -1 5 inin organik bileiklerin yapsna getii gzlem lendi. Karbonun yzde 2si proteinlerin yapsn oluturan am ino asitlerin yapsna katlrken, eker, ya ve nkleik asitlerin baz yaptalar da retilen organik bi leikler arasndayd. (ekil 79)

leik asit bazlar inorganik bileiklerden indirgen atm osfer koullarnda retildi.

Miller deneyindeki soru iaretleri ve yeni bulgular


1 9 9 0 lara gelindiinde bulunan kantlar, ilksel D n ya ortam nda youn olarak karbond ioksit ( C 0 2) ve bir m iktar da azot (N 2) bulunduunu gsterdi. Bu gazlar M illerin deney b alonu nun iinde bulunm ayan gazlar d. K aliforniyada bulunan Scripps O kyanus B ilim leri E n stit s nden Prof. Jeffrey Bada ve grubu (Jeffrey Bada, M illern ilk rencilerind en b irisi) bu yeni gazlar ek le yerek M illern deneyini tekrar etm eye altnda n e redeyse hi am ino asit retm eyi baaram ad. Bu sorun ise yle ald: lk atm osfer ortam nda yeterli m iktar da dem ir ve karb o n at m ineralleri bulunm u olabilir, ki bu b ileik ler ortam a ek len erek deney tekrarlandnda, zengin am ino asit ierii elde edildi. Buradaki m ineraller n itritlerin etkisin i n tralize etm i olabilir. Son u olarak, ortam da karb o n d io ksit ve n itro jen in b u lu nm as, am ino asitlerin olum asn engelleyecek ned enler olm ayabilir. Bada ve grubu, Stanley M iller ve Harold U reyin bundan 5 0 yl nce yapt deney rn ek lerin i de tekrar analiz etti. Daha m odern tekn ikler k ullan larak yaplan in c e lem elerde, deney rneklerind e aslnda M iller ve U reyin 5 0 yl nce bulduklarndan daha fazla organik m olekl rediini ortaya kardlar. Grup, M iller ve U reyin yaptklar ancak yaym lam a dklar dier bir deneyin sonularn da analiz etti. V olka nik dzenek olarak adlandrlabilecek bu deney, bilinen M iller deney dzeneinden ok az bir farkllk ierm ek teydi. E lektrik akm ierisinden buhar geiinin daha hzl saland bu dzenekte, volkan evresindeki ortam olu turulmaya allm t. Bada ve grubu orijin al deneyde as lnda 2 2 am ino asitin ve dier baz organik m olekllerin rediini ortaya kardlar. Gruba gre, buharn daha hz l gem esi avantajl bir durum oluturm u olabilir: Yeni oluan am ino asitler hzl bir ekilde elektrik alanndan uzaklatrlabilir ve bylece oluan dier m olekllerle de

Dier deneyler
M iller-U rey deneyi, benzer birok deneyin ya plm asna yol at. 1 9 6 1 de Ju an ro, su ortamnda h idrojen siyanr (HCN) ile amonyan elektrik akm na tutulmas sonu cu nkleik asitin yaptalarndan adenin baznn oluum unu gsterdi. D e ney sonucunda ek olarak eitli amino asitler ve baz porfirinler de (drt tane pirol halkasnn m e tilen kprleriyle birleerek oluturduu halkal m olekller) retilm iti. Daha sonra yaplan baz deneylerde de dier nk-

e k il 79. U rey-M lller Deneyi'nde eletrodlardan salanan kvlcm lar lk atm osferdeki yldrm lar temsil ediyor. Souk su sayesinde elde edilen rneklerin younlaarak su ortam na gemesi salanyor: ilk atmosferdeki bileiklerin yam urlarla okyanuslara tanmas gibi. O kyanus blmesi de stlarak bileiklerin tekrar atm osferik blm e gitmesi ve yeni bir dngnn balamas salanyor. Elektrodlar
K

N t-l : C X V f
Atmosferik; blm Okyanus blm

4 .H S

Souk su

Yogunlama-

II
s

<r*~

j rn e k alm

134

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

135

reaksiyona girm eyerek yaplarn koruyacaklardr. imdiye kadar M iller ve Urey deneyinin atm osferin ilk koullarn tam olarak doru yanstm ad yolunda ele tiriler ska yaplmaktayd. G erekten de deney tpnde ki ortam ilk atm osfer ortam n tam olarak yanstm yor, ancak gezegen zerinde, baz ufak blgelerdeki artlar doru olarak yanstyor olabilir. Yeni oluturulm u bir m olekl gne na maruz kaldnda yksek enerjinin etkisiyle paralanacaktr. Bu yzden de reaksiyon su al tnda ya da baka korunakl bir yerde olmaldr. Badaya gre M illern deneyindeki gazlar ilk Dnya ortam nda aktif haldeki birok volkandan dar salnm olabilir ve birok byk volkan patlamas srasnda olu an im ekler de elektrik kaynan oluturabilir.

hcreler nasl olutu? Bu noktada, ok kritik bir adm n gereklem esi gerekiyor: Bu da kendini kopyalayabilen bir molekln/sistemin gelim esi ve devam lln srd rebilm esidir. lk defa kendini kopyalayabilm e zelliini kazanan molekln/sistemin ne olduunu kesin olarak bilem esek de baz hipotezler bu sreci aklam aya al yor. Bu hipotezlerde iki farkl grn hkim olduunu syleyebiliriz. Bir ksm bilim insan, en yaygn fikir olan, ncelikle n kleik asitlerin ortaya kt fikrini savunur ken (n ce-gen ler), bir ksm bilim insan ise ncelikle biyokim yasal reaksiyonlarn ve yol-izlerinin (pathways) ortaya ktm dnm ekteler (nce-m etabolizm a). N kleik asitler ya da m etabolik yol-izleri, hangisi ilk ge lirse gelsin, kendini srdrebilm i ve sahip olduu bilgiyi sonraki nesillere aktarabilm i olm aldr. im di bu hipotezler arasnda en yaygn olarak kabul gren RNA dnyas hipoteziyle balayalm. n ce g e n le r m o d eli: RN A d n y a s h ip o te z i RNA dnyas hipotezine gre, organik m olekllerden ilk hcrenin olum asna geilirken ilk oluan karm ak m olekl DNA ya da protein deildi. Kendini kopyalaya bilen ve katalitik (enzim gibi alyordu) zellii olan RNA, dier m olekllerden nce ortaya km olmalyd. RNAn n iki ezellii onun DNA ve proteinden nce geldi i fikrini kuvvetlendiriyor. Birincisi ayn DNAda olduu gibi RNA da bilgi depolayabilir. Eer RNA bir ekilde k en dini kopyalayabilirse, depolad bilgiyi de sonraki nesil lere aktarabilir. Burada da RNAmn nem li ikinci zellii belirleyici oluyor. Enzim lerde olduu gibi baz RNA m o leklleri katalitik zellik gsterebilir. R ib o z im le rin (R N A en z im ) k e fi Proteinlerin hcre iinde farkl grevleri bulunur. Ancak en temel grevleri hcrenin devam iin gerekli kim yasal reaksiyonlar katalizlem ektir. Hcrede kata lizlem e grevi gren proteinlere enzim ad verilir. Son zamanlara kadar, enzim lerin sadece proteinlerden mey-

*5 I Kendini oaltabilen 3 Zm I ilk molekl/sistem hangisidir?


Hcre ok karmak bir yapdadr. Bu yzden de kendili inden birdenbire ortaya km ak yerine, belirli basamaklar dan geerek olumu olmas daha mankldr. Benzer ekilde hcrenin iindeki birok molekl de karmak yapdadr. O halde ilk hcrenin ortaya kna kadar geen srete nce en basit molekller toplanm, devamnda hcre yapsnda bulunan daha karmak molekller olumu ve devamnda da evreleri bir zarla evrilmi olabilir. Bu aamada hangi sinin daha nce olduunu sylemek ok kolay deil. Basit bir zar yaps ile evrildikten sonra, hcrenin iindeki daha karmak molekller olumu da olabilir. O rg a n ik m o le k lle rd e n ilk h c re le re g ei: K e n d in i k o p y a la y a b ile n m o le k ller/ siste m le r Bir nceki blm de, zellikle M iller ve Ureyin deney lerini anlatrken, basit organik m olekllerin ilk dnya or tam nda nasd olum u olabileceinden bahsetm itik. im di b ir sonraki admdayz. Bu organik m olekllerden basit

136

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

137

dana geldii dnlyor du; ancak 1 9 8 0 lerin b a larnda Sidney Altman ve Thom as C ech, birbirinden bamsz olarak yrttk leri alm alarda baz RNA ekil 80. Katalitik zellie m olekllerinin de kimyasal sahip ribozim rnei. Bu RNA reaksiyonlar katalizleyebil m olekl karmak -boyutlu ekillere girerek B -12 vitam inine dikleri, yani enzim grevi balanabilir. Kaln izgi RNA'nn grebildiklerini ortaya om urgasn; ince izgi, begen ve kard. Bu tr RNAlara riboaltgenler ise bazlar ifade eder. zim (RNA enzim ) ad veri lir. (ekil 8 0 ) Bu bulularndan dolay Altm an ve C ech 1 9 8 9 da kim ya dalnda Nobel dl ile dllendirilm i tir. Bu nem li bulu bizi canlln ilk zam anlaryla ilgili nem li bir hipoteze getiriyor.

M
/ ' /

0 *

Amino asit

f f

Nkleo,id * o) RNA oluur

b) Ribozimler RNA kopyalamasn katalizler

Protein t) RNA protein sentezini

" -jj^ s H H c tr r e zar

RNA

K k )J

-i*

e) Proteinler hcre aktivitelerini katalizler_________ d) RNA, DNA ve proteini kodlar

ekil 8 1 . RNA dnyas hipotezine gre D N A'dan nce RNA vard;


proteinler gibi katalitik zellik tayordu ve DN A gibi bilgi depolayabilirdi.

RNA dnyas hipotezi


Enzim grevi gren RNAlan n ortaya k, 1 9 6 0 l yl larda ortaya atlan bir hipotezi de desteklemi oldu. Bir birinden bamsz olarak, Cari W oese, Francis C rick ve Leslie Orgel tarafndan ne srlen bu hipoteze gre, ilk dnya ortamnda DNA ya da proteinler ortaya kmadan nce RNA vard ve hem 'genetik bilginin saklanmas hem de enzimatik aktivitelerin gereklemesi grevini yerine getiriyordu. Bu hipoteze RNA dnyas hipotezi ad veri liyor. Ribozimlerin kefinden yllarca nce ortaya srlen bu hipotez, bilim dnyasnda ok geni kabul gren bir h i potezdir. RNAnn DNAya gre daha basit bir yaps olmas nedeniyle nce RNA ortaya km olabilir; ancak daha da yankl yaps sayesinde DNA sonralar baskn hale geerek, genetik bilginin tanmas roln almtr. RNAnm enzi m atik zellii vardr, ancak proteinlerle karlatrdmz da dk bir seviyededir. Bu yzden de proteinler gelitik e katalizr grevini RNAdan byk oranda devralmtr. RNA dnyas hipotezinin en nem li kantlarndan birisi, hcrelerde bulunan ve ribozom ad verilen organellerdir. R ibozom larn yapsnda RNA ve proteinler

bulunur ve bunlar hcrede proteinlerin sentezlendii yer dir. A ncak bu sentez srasnda katalitik grevi yapanlar ribozom un yapsndaki proteinler deil RNAlardr. Bu da RNAnm ilk dnya ortam nda proteinlerden nce katalitik grevi yerine getirm i olabileceini gsteriyor. (ekil 8 1 )

RNA dnyas hipoteziyle ilgili son almalar


RNAy oluturan yaptalarna nkleotid dendiinden ve her bir nkleotidin de azotlu bir baz (h er bir nkleotidi birbirinden ayran h arf d enebilir), bir eker m olekl ve fosfat grubundan olutuundan bahsetm itik. Yllar b o yunca aratrm aclar, eker ve bazlar retip birbirine ba layarak ve devamnda da fosfat grubu ekleyerek RNA mo lekl yapmay denediler. Ancak bunda baarsz oldular. Bilim insanlarnn burada ulatklar sonu u oldu: RNA, DNA ve proteinden daha nce ortaya km olabilir; an cak birdenbire ortaya kam ayacak kadar karm ak bir yapda grnyor. Bu yzden ilk dnya ortam nda RNA m olekl, basite eker, baz ve fosfat gruplarnn birle mesiyle olum u olm ayabilir. Araya baka m olekller gir m i ve devamnda RNA olum u ve kontrol ele alm ola bilir. Baz aratrm aclara gre RNA m erkezli yaam, daha nceden yaam ve deiik bir genetik materyal kullanan baka organizm alardan evrilmi olabilir. Bu hipoteze gre PNA (peptit nkleik asit), TNA (treoz nkleik asit) ya da GNA (gliserol n kleik asit) denilen genetik m olekller,

138

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

139

RNAdan daha nce ortaya km olabilir. Bu m olekller DNA ve RNA yapsna benzerlik gsterse de, tem el yap olarak farkldrlar. Bu m olekller ilk oluma aamasnda RNAnn karlaabilecei zorluklarla karlam adan daha kolay bir ekilde meydana gelm i ve daha sonra ise yerle rini RNAya brakm olabilirler.

nce metabolizma modeli: Demir-kkrt dnyas hipotezi


Bu hip otezin tem el fikrin e greyse, ilk olarak gen de il, ilkel m etabolizm alar ortaya k t. Bu m etabolizm alar daha sonra gelecek RNA iin uygun ortam oluturdu. Bu fikrin ilk rnekleri A lexander O p arin in 1 9 2 4 de ne srd kendi ken d ini oaltabilen vezikl (k esecik ) fikriyle ortaya k t. 1 9 8 0 lerde Alm an kim yac G nter W ach tersh au serin ne srd d em ir-k k rt dnyas h ip otezi ise bu fikrin en son rneklerind endir. Bu h ip o teze gre, ilk yaam d em ir-k k rt m ineralleri zerinde olum u olabilir. n celik le kendi en erjisin i retebilen kapal m etabolik dngler olum u ve daha sonra bu dng ierisind e RNA gibi karm ak m olek llere ge ilm itir. Bu reaksiyonlar da byk ihtim alle okyanus diplerinde bulunan h id roterm al bacalarn evrelerinde gereklem iti.

ekil 82. Tipik bir hcre zarnda karlkl iki fosfolipit katm an bulunur.
Bu yapnn iinde gm l olarak ya da altnda zar proteinleri ve karbohidratlar, glikoproteinler ve g likolipitler bulunur.

yor. Bir zarla evrili olm ak iki tem el avantaj salayacaktr: G enetik m ateryalin rnleri yakn bir evrede tutulacak ve zar yaps sayesinde d ortam dan farkl b ir i ortam salanabilecektir.

Hcre zar: D ortam ile i ortam arasna bir snr ekmek


Zarlar h crenin ieriini fiziksel olarak bir arada tutar ve d ortam dan ayrr. Dier bir deyile, h cren in rnle ri yakn bir ortamda tutulm u olur. Zar byk m oleklle rin kontrolsz olarak giri kn durdurur. Zar ierisine yerlem i baz proteinler, birer kap grevlisi gibi alr ve m oleklleri hcre iine ya da dna pompalarlar. Baz proteinler ise hcre zarnn yapmnda ve tam irinde g revlidir. Grld gibi m odern hcrelerde bulunan h c re zarlar ok farkl m olekller kullanarak, gelimi fonk siyonlar meydana getirebiliyor. M odern hcre zar yapsna yakndan bakldnda, te mel olarak ift katl lipit katm anndan olutuunu gr yoruz. Yas yaplaryla fosfolipitler ve kolestrol bu ift katl katm ann tem elini oluturur. Zar arasnda ise pro teinler, glikoproteinler, lipoproteinler, glikolipidler bulu nur. (ekil 8 2 ) ift katl yapy oluturan fosfolipidler ise, yaplarnda

*5 O I k hcre zar 3 3 I nasl olutu?


B ilim insanlar ilk hcrenin nasl ortaya ktn kesin olarak bilem iyor. Ancak zellikle son zam anlarda yap lan aratrmalar, ilk Dnya ortamnda genetik materyalin evresinde basit bir zar yapsnn olum asnn ok da zor olm adn ortaya koydu. Kendini kopyalayabilen ilk m olekl ne olursa olsun, RNA enzimi ya da dier nc m olekller, basit de olsa bir zarla evrilerek kendini korum a altna alm grn-

140

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

141

-... h
H0
h h H H H h h

Karboksil grup

Hidrokarbon grup

* Polar grup: Suya ynelen

*45* *

Apolar grup: Sudon uzaklaan (Ya asidi)

Polar grup (Su seven) Apolar grup (Sudan kaan)

ift katl lipid zar

Misel

Vezikl

ekil 83. stte ya asidi ve fosfolipit rnekleri. Altta se fosfolipitlerin bir


araya gelmesiyle oluan ift katl zar, misel ve vezikl yaplar. Basit bir ya hcresi lk hcre zarlarnn temel yapta olabilir. Fosfollpltler de m odern hcre zarlarnn yapsn oluturur. Vezikl ve misel de ya asidi ya da fosfollpltler tarafndan oluturulabilir.

bir ya da iki ya asidi, fosfat grubu ve bir alkol grubu ie rir ve zarn olum as asndan ok belirleyici bir zellie sahiptir. Bir ular p o la r(8) zellik gsterirken, dier ular ise apolar (8) zellik gsterir. Bu m olekller sulu bir orta ma brakldnda, apolar ksm lar sudan uzaklaarak bir araya gelmeye alr. rnein suya ya damlatldnda ya dam lacklar bir araya gelerek yzeye doru ynelir. (ekil 83 )

m o lek llerin olutuu ne s rlm t. A ncak Harvard n iv ersitesind en Ja c k Szostak ve ek ib in in yapt a lm alar, b a sit yapdaki n k le o tid lerin yin e b asit y ap daki zarlardan kolayca g eeb ild i in i gsteriyor. (Ja ck Szostak 2 0 0 9 yln d a F iz y o lo ji ve Tp alannd a N obel dl k azan m tr.) Grup, basit bir hcrenin evreden salanan kaynaklar la genetik bilgisini kopyalayp kopyalayam adm grm ek iin bir deney tasarlad. inde tek zincir halinde bulunan ksa bir DNA paras ieren ve hcre zar ya asitlerin den oluan bir hcre oluturdular. Bu basit hcre iindeki DNA paras, genetik bilginin sonraki nesile aktarlaca bir kalp grevini grd. Devamnda ise bu hcreler kim yasal olarak reaktif olan nkleotid ieren bir ortama alnd. Hcre dndaki nkleotidlerin kendiliinden h c re iine tand ve tek zincir halindeki DNA zerine ba lanarak DNAnm ikinci zincirini oluturduklar gzlendi. (ekil 8 4 ) Bu sonular da ilk h crenin RNA gibi tek zin cirli basit bir m olekl ierdiini ve proteinler olmadan da kendini oaltabildii fikrini destekliyor.

lk hcrelerin blnmesi
Yukarda bahsettiim iz basit yapdaki bu ilk h crele rin soyunu devam ettirebilm esi iin ncelikle bymesi ve genetik m alzem esini kopyalayarak iki katm a k ar mas gerekliydi. Yaplan deneyler basit keseciklerin (ya kesesi-vezikl) tem el olarak iki farkl yolla bydn gsteriyor.
ekil 84. Ya asitlerinden oluan hcre zart tek zincirli bir D N A ieriyor.
O rta m d a bulunan DN A yaptalar (nkleotid) kendiliinden hcre iine giriyor ve D N A zerine balanarak D N A y oaltyor.

lk basit hcre zarlar


ilk basit zarlar, byk ih tim alle ya asitleri gibi b a sit m olek llerd en olu m u olm ald r. 1 9 7 0 lerin so n larnd a yaplan aratrm alar, ya asitleri b ir araya ge tirild i in d e, k en d ili in d en zar yaps olu tu rd u k larn gsterm iti. A ncak bu zar yaplaryla ilgili genel gr, b asit yapda o lsalar da n k leo tid ve dier b esin m adde le rin in h cre iin e giriin i byk lde en g elled ik leri ynndeydi. Bu fik ir yznden, ilk h creler geliirken n ce lik le m etabolizm ann gelitii ve zarla ev relen d i i, daha sonra h cre iind e daha b y k ve karm ak
8 ) P o la r: H id ro filik , suya y n e le n . A p o la r: H id ro fo b ik , su d an k a a n .

* a j _ .* *4 .u" ' * < K , *- H m A ** O x * - \\ % *

S \ i\ i \ M *

^ 3 1

t *U

: ZT ~t < *

i* 1

- V 'A S.

142

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

143

1 9 9 0 larda sve Fed eral T e k n o lo ji E n stit s nden P ier Luigi L uisi ve ek ibi, y aptklar alm ada, iind e k esecik ler bu lu nan suya dardan ya asitleri ek led ik lerind e, k esecik lerin dardan gelen bu ya asitlerini yaplarna k atarak bydn gsterdiler. Bu basit h cre iin e dardan su ve znm m o lek ller girm e ye devam ettik e, k eseci in hacm i de bym eye devam ediyordu. ik in c i y n tem ise, Ja c k Szo stak m alm a grubunun ortaya k ard , ilk h creler (p ro to ce ll) arasn d aki re kabete dayanan bir yol. in d e RNA ya da z nm m o lek ller bu lu nan h cre yaps, dardan ieriye giren suyla im eye balayacak ve bu da h cre zarna bask yapacaktr. O zm o tik b asn , h cre iin d ek i ve d n d aki su younluunu d engelem eye alacak tr. Bu b a sn c azaltm ak iin h cre zarnn g en ilem esi g ere k ece k tir. H cre zar y akn evrede b u lu n an dier h cre zarlarnd an k op arabild ii ya a sitle rin i k en d i zar yap sna katarak ierd ek i b asn c azaltm a yoluna g id ecektir. Zar y apsn g eniletem eyen ya da kom u h crelere zar dan para kaybeden h creler de k lece k ya da yok o lacaktr. G rld gibi, uygun yaptalar salandnda ilk h crelerin olum as o k zor grnm yor. Ya a sitlerin den oluan b ir zar yaps, polim er yapsna g elebilecek RNA gibi b ir m olek l n evresini sararak ilk h cre ya psn oluturm u olabilir. H cre iin e dardan gelen su ve znm m o lek ller h cren in bym esini ve uygun zam anda bl nm esini salam tr. Bu aam alarda kom u h creler birbirleriyle rekabet iinde olacaklar, b aarl olup sayca oalanlar soylarn devam ettire b ilecek tir. Burada d enenen ve ilk ortam da olduu dnlen g en etik m ateryal RNAdr ve norm alde tekli zin cir yap sndadr. H cre iin e dardan alm an n k leo tid ler RNA zerinde balanarak RNAy ift zin cir haline g etirecek tir. A ncak h cren in devam ed ebilm esi iin bu ift zin cird en oluan RNAnm tekrar tekli zin cir hale dnerek

k en d in i kopyalayabilm esi gerekir. B irb irin e bal iki RNA z in cirin in ayrlm as da ken d iliin d en g erek le m eyen, en e rji g erektiren b ir ilem dir, ilk e l dnya or tam nda bu durum iin volkanlard an salanan yksek s en erjisi kullan lm olabilir. Scak b lgelere yakn b ir blgede bu lu nan souk b ir ortam sayesinde de tek z in cir halind e ayrlm olan RNA m olek l kalp olarak grev yapabilir. B ylece kend ini kopyalam olacaktr. Y ksek sca k lk farklarn n olduu yerler bu i iin e l verili grnyor. O kyanus d iplerind eki hidroterm al bacalarn sca ve evredeki derin okyanus suyu ya da buzlu blgelerd eki volkan ik blgeler gibi. Szostakm grubunun laboratuvar ortam nda oluturduu k esecik ler (zarla evrili RNA p aralar) 100 C scakla kadar bozulm adan kalyor. Y ksek scak lk lard a bu ilk h cre ler n k leo tid leri dardan daha kolay alrk en , daha d k scaklklard a ise yeni RNA m o lek llerin i daha hzl retiyor. Szostaka gre ilk Dnya ortam nda, dk ve yksek scaklklarn bir dng olarak bulunduu yerlerde, ilkel bir hcre oluturm ak zor deildi. Zarlar yksek scakla dayanabiliyordu. Yine yksek scaklkta ift zincirli RNA tek zincir halinde alabilir, daha souk bir ortamda ise bu tek zincirli RNAlara nkleotidler balanarak yeni ift zin cirler oluturabilirdi. Bu dng srd srece hcreler byyecek ve blnecekti. evre tarafndan balatlan bu kopyalam a ilem i hc rede devam ettirildiinde, evrim de devreye girecek ve her bir kopyalama srasnda meydana gelen hatalar, yani m utasyonlar, yeni nesillerin farkllam asna neden ola caktr. Belirli bir noktada ribozim ler evresel etki olm a dan kopyalama iini yapabiliyor duruma gelm i olmal. Zaman ilerledike zar yaps gelim i ve proteinler RNA enzim lerinin yerini alm tr. Anlalan o ki, belirli bir za man sonunda da RNA dnyas yerini DNA dnyasna b rakmtr.

144

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

145

I Eeyli reme nasl ortaya kt? I Avantajlar nelerdir?


reme b ir canlnn oalarak soyunu devam ettirm e sidir. Belirli bir bym e ve gelim e evresinden sonra, or ganizmalar yeni bireyler oluturarak genetik bilgilerini aktarr. nceki konularda ilk hcrenin oluum undan bahset m itik. O zamandan eeyli rem enin ortaya kt ana kadar geen srede, dnya zerinde var olan organizm a larn tekhcreli olduunu ve eeysiz olarak rediklerini syleyebiliriz. Eeyli rem enin ortaya k, canl evri m inde meydana gelen devrimsel bir admdr. Bu nem li basam an anlalm as iin ncelikle eeyli ve eeysiz re m enin ne dem ek olduundan bahsetm ek gerekiyor. Eeysiz rem e: ekil 8 5 de olduu gibi, eeysiz reme, basit bir ekilde tek bir hcrenin blnerek birbirinin ayn iki hcreyi oluturm asdr. H cre blnm e aam as na gelm eden nce bym esini tam amlar, genom unu kop yalayarak iki katm a karr. Blnm e ncesinde yeni h c re iin her ey hazrdr. Eeysiz rem e mayoz, krom ozom saysnda yarya inm e (ploidy) ya da dllenm e ierm ez. T ek bir hcrenin blnm esi sonucu meydana gelir. Arkea, bakteri ve protistalar(karyot) gibi tekhcreli can l larn temel blnm e m e
ekil 85. Eeysiz remede hcre
nce boyut olarak a rtar ve DNA'sn kopyalayarak iki katna karr. Daha sonra D N A bltrlerek iki benzer hcre oluturulur.

polendir. (ekil 86) Hayvanlarda, b itk i lerde, mantarlarda ve tekhcreli karyotlar

ti
Yumurta (n) %

flB s e k
Zigot (2n)

\
Embriyo*

^0%

todudur. B irok b itk i ve m antar da eeysiz olarak reyebilir. (ekil 85) E eyli rem e: Eeyli rem e ise, ayn trden ik i farkl bireyden gelen eey hcrelerinin dl lenm e sonucu bir araya gelm esiyle olan rem e dir. Dii eey hcresi yum urta, erkek eey hcresi ise sperm ya da

| H C V ^ " _ _
Kromozom

r'

V ,.
~~ Kromozom

DNA kopyalanmas

olan protozoalarda g Sperm (n) rlr. Eeyli remede ekil 86. Sperm ve yum urta bir araya ayn trden iki bireyin gelerek zigotu oluturur. (erkek ve dii) gene tik bilgisi dllenm e sonucu yavru genom unda birleir. Bu genetik eitlilii arttracaktr. Meydana gelen tem el iki ilem krom ozom saysnn yarya dm esini salayan mayoz blnm e ve iki eey hcresinin birlem esiyle k ro mozom saysnn tekrar norm ale dnm esini salayan dl lenm edir. Mayoz blnm e srasnda hom olog krom ozom (9) iftleri yan yana gelerek para deitirirler (hom olog rekom binasyon). Bilinen ilk eeyli oalan organizma fosili bir karyota aittir. Fosil 1-1,2 milyar yl ncesinden gnm ze kalsa da, eeyli rem enin ortaya k 2 milyar yl kadar n ce ye gidiyor olabilir. Bu zamandan daha ncesinde dnya zerindeki tm canllar tekhcreliydi ve eeyli reme e kirdekli hcrelerin, yani karyotlarm ortaya km asndan sonra ortaya kt. Eeyli rem e karyotlarm ortak atasnda ortaya k m tr, ancak baz karyot trlerinde bu zellik daha sonralar ortadan kalkm tr. Bu yzden baz karyotlar eeysiz reyebilm ektedir. Yeni tekniklerle yaplan al malar, eeysiz olarak reyen organizm alarn genom unda eeyli rem eyle ilgili genlerin de varln gsteriyor. Bu da eeysiz ynnde deiim in daha sonradan meydana gelm i olabileceine dair bir iaret. Eeyli ve eeysiz re m enin daha iyi anlalm as iin baz terim lerden bah set m ek gerek. D iploid ve haploid organizm a: Tm omurgallarda o l duu gibi, insanlarn hcrelerinin tam amna yakn dip9) H o m o lo g k ro m o z o m : B iri anneden biri babadan g elen , ek il ve byklk bakm ndan ay o lan , ayn pozisyon larda ayn gen leri barndran k ro m o zom iftidir.

ayrlmas

vs D
s* _ "\
V, Hcre blnmesi

UT)

146

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

147

Haploid Dllenme

Diploid

e k il 8 7 . Eeyli remede diploid ve haploid krom ozom says arasndaki dng. Mayoz ile yarya inen krom ozom says, dllenm eyle iki katna kar ve sonu olarak da trde kromozom says sabit kalm olur.

loid hcredir. Bunun anlam hcrede birbirin in benzeri iki dizi krom ozom bulunm as dr. Birbirine benzer krom o zomlara hom olog krom o zom ad verilir ve diploid says 2n olarak ifade edilir. rnein, insanda 2 n = 4 6 dr. 4 6 krom ozom vardr, ancak 23 ift birbirinin benzeri k ro mozom vardr da diyebiliriz. X ve Y krom ozom lar da son ifttir. Ancak vcutta haploid (n) hcreler de vardr. Eey hcreleri olan sperm ve yu murta hcrelerinde 23 adet

krom ozom bulunur. Bunlarn 2 2 si hom olog krom ozom ve 1 tanesi de X ya da Y krom ozom udur. Mayoz ad veri len blnm e ile 2n = 46 krom ozom dan n=23 krom ozom a blnr. Mayoz blnm e srasnda hom olog krom ozom lardan hangisinin alnaca ansa baldr. Devamnda da bir erkek bir diiyle iftletiinde, eey hcreleri bir araya gelerek birleir ve oluan zigotta krom ozom says tekrar 4 6 ya kar. Bylece trdeki krom ozom says sabit kalm olur. (ekil 87)

nce bu soruya youn olarak cevap aramaya balad. 1 9 7 1 de ngiliz evrim biyologu Jo h n M aynard Sm ith, erkek yavrularn bir anne iin ne kadar m aliyetli e k il 8 8 . Eeysiz remeye gre seksin olduunu gstererek, (eeyli remenin) iki kat m aliyetli olduu grlyor. Eer her b ir birey ayn sayda aratrm alarn nn (2) yavru veriyor olsayd; a) eeyli reyen de am oldu. Eey poplasyonun birey says ayn kalrken, b) siz reyen bir dii yine eeysiz reyen poplasyonun birey says her jenerasyonda iki katna kacaktr. dii yavrular olutu (E: Erkek, D: Dii) racaktr. Bir hcreden iki hcre oluur ve bu iki hcre de blnm e kapasitesine sahiptir. Ancak eeyli reyen bir diinin yavrularnn dii olm a olasl yzde 5 0 dir. Bylece yavru dourabilm e zelliine sahip hcre says yarya dm olur. Bu yz den eeysiz reyen bir organizma iki kat daha hzl oa lacaktr. Bu eeyli rem enin eeysiz rem eye oranla iki k a t m aliyetli olduu anlam na gelir. (ekil 8 8 ) Dier bir m aliyet ise udur: Eeyli rem ede dii ve er kekler elem ek iin birbirini arayp bulm ak zorundadr. Ayrca eeyli rem e, ounlukla bireylerin devamlln riske atan zellikleri tercih eder (cinsel seilim ).

Neden eeysiz remeden eeyli remeye geilmitir?


Bugn bilim insanlar eeyli rem enin nasl gerekle tiini ayrntlaryla biliyor, ancak kesin olarak bilinm eyen nokta, eeyli rem enin ilk olarak neden ortaya ktdr. Birok hipotez eeyli rem enin ilk ortaya km akla maya alyor, ancak en doru yaklam hipotezleri bir arada deerlendirm ek olacaktr. Soru udur: Bir organizm a kendi bana blnp oal mak varken neden rem ek iin bir e arama gerei duyar ve eeyli rem enin btn o zorlu gereklerini yerine ge tirm eye alr? Bilim insanlar gnmzden 4 0 yl kadar

Peki bu maliyete karn neden eeyli reme ortaya k mtr ve neden hl devam etmektedir?
Birok bilim insan mayoz blnm e ve eeyli rem enin ayn zamanda ortaya ktn sylemektedir. Ancak Cam b ridge niversitesinden Adam W ilkins ve Avustralya Bilim ler Akademisinden Robin Hollidaye gre tarihsel geliim yle gereklem itir: ncelikle haploid (n) organizmalar vard. Zamanla bu hcrelerin DNAlar dardan katlan m obil elementler yoluyla (virs DNAlar) ok byd. Hcre oalrken tm DNAy kopyalyordu, ki yle bir noktada hcre artk kopyalad DNAsn blememi olabilir. Benzer ekilde iki haploid hcrenin birlem esiy le de DNA m iktar iki katm a km olabilir. O halde ilk aama byk olaslkla hcre iindeki DNA m iktanndaki

148

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

149

arttr. Bunu mayoz blnm enin gelimesi takip etm i ola bilir. Normalde mayoz srasnda hom olog krom ozom lar arasnda para deiimi yaanr. Ancak bu deiim farkl krom ozom lar arasnda yaanacak olursa, organizmann lmyle sonulanabilir. Bu yzden mayoz srasnda ben zer krom ozom larn, yani hom ologlarn bir araya gelmi olmas ve para deitirmesi daha avantajl olacaktr. Bu yzden denebilir ki, mayoz yanl eleen krom ozom lar dolaysyla oluacak zarar engellemek iin gelimitir. Mayozun geliimiyle hcredeki krom ozom says yarya indirilebilm i oldu. Mayozda yer alan hom olog rekom binasyon da hcrelerin genetik materyalini etkili ve gvenli bir yolla oaltmalarn salad. Rekom binasyon sayesinde genetik materyalde oluabilecek hatal ksm lar dzeltilebi lir. Haploid bir organizmada ise, genetik materyalde mey dana gelecek bir hata byk olaslkla kalc olacaktr. okhcreli organizmalarda eeyli rem enin grlm em e si nadirdir. Deiken olmayan ortamlarda, hcre saysnda hzl bir art gerektiinde, eeysiz reme gerekli olmu ola bilir; ancak deiken bir ortama uyum salamaya yarayacak genetik deiiklikler eeyli remeyle elde edilebilir. T el Aviv niversitesinden Lilach Adony ve British Colum bia U niversitesinden Sarah O tto, m atem atiksel modellem elerden yararlanarak, eeysiz rem eden eeyli re meye nasl geilm i olduunu aratryorlar. Gruba gre, eeysiz reyen organizmalarda bulunan baz genler saye sinde organizma belirli koullarda (bask koullarnda) eeyli remeye geiyor. Eeysiz rem e bir seenek ya da sem eli bir durum. Ortam artlar norm ale dndnde bu genler kapanyor ve organizma tekrar eeysiz remeye geiyor. Bu strateji gnmzde baz mayalar ve bitkiler tarafndan uygulanmaktadr. G erektiinde eeyli rem eye gei olm utur diyoruz, peki b ir organizma tmyle eeyli rem eye nasl gem i tir? Bunun ilk nedeni sek s el seilim olabilir. Yani bir or ganizm a elem ek iin dier organizm alar arasndan se im yapar. Seksel ekicilie sahip b ir organizma, eeyli

reme yoluyla, eeysiz reyerek meydana getireceinden ok daha fazla yavru oluturabilir. O rganizm ann e bula bilm esini arttran m utasyonlar, sonuta seksel olarak se ilm e ansn arttracaktr. Daha gzel kokan, daha renkli tyleri olan ya da daha etkileyici sesi olan birey dierleri ne gre daha ncelikli seilecektir. Eeyli remeye geii tek bana seksel seilim le ak lam ak yeterli deildir. Eeyli rem e yoluyla elde edilecek avantajl farkl durum lar vardr. ncelikle farkl orga nizm alardaki yararl m utasyonlar seilerek bir araya ge tirilir. Bu ise organizm ann devam asndan avantajl bir durumdur. Eeysiz reyen bir organizma ise varolan m tasyonlar byk oranda koruyacaktr. Dardan fay dal m utasyon alma ans yoktur. Benzer ekilde zararl m utasyonlar da eeyli reme yoluyla elenebilir. Eeysiz reyen bir hcrede ise zararl m utasyonlar birikecektir. Son olarak ise, bir ortamda baskn hale gelm i bir orga nizm a kanlm az olarak parazit saldrsna urayacaktr. Eeyli rem e yoluyla bu saldrya kar koym ak ok daha kolayken, eeysiz rem e yapan organizma byk o laslk la yeterli karl verem eyecektir. Buna kzl kralie (red queen) hipotezi ad verilir. Seks eeysiz remeye gre iki kat m aliyetli olm asna ve toplam yavru saysn azaltm asna karn, yeni nesillerin evreye olan uyumunu arttrarak evrimi hzlandrm tr. Bu da tem elde genetik eitliliin artm asyla salanr. Tm bu farkl avantajlar bir arada dnm ek, eeysiz rem eden eeyliye neden geilm i olabileceini akla makta faydal olacaktr.

^ 3

J | okhcrelilik 3 I nasl ortaya kmtr?

Bilim sel kantlar dnya zerindeki ilk organizm alarn tekhcreli olduunu gsteriyor. okhcreli organizm a larn ortaya k o k daha sonralar olm utur. Genel

150

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

151

t e m L 0 '9 lK A R Y O TLA R M a n ta r la r ______________ BAKTERLER S iy a n o b a k te ri M yxom ycete A k tin o m js e t F a ro m m ife ra H a y v a n la r ^

anlam da okhcreli or ganizm a dediimizde, birden ok hcresi olan, ancak ortak bir genom yapsyla ynetilen bir organizm adan bahsedi yoruz. rnein, insan vcudunda trilyonlarca hcre bulunur, ancak

H ipotezlerden ilki, sim biyotik teori adn tayor. Bu teoriye gre, tekhcreli farkl trden canllarn b ir araya gelerek yaamaya balad ve h er b ir h cren in de farkl bir rol stlendii gruplar okhcrelilie geiin tem elini oluturur. Zaman iinde bu hcrelerin birbirine olan ba m llklar artm ve tek balarna yaayamaz hale gelm i lerdir. Dier bir teori olan k oloni teorisine gre, ayn trden tekhcreli organizm alarn sim biyosis benzeri bir iliki iinde yaamas sonucu, okhcreli organizm alar ortaya km tr. Sonu olarak hcrelerin genom larnn b irle mesiyle, tek bir organizma haline gelm ilerdir. Bu genom birlem esinin nasl olduu henz aklanabilm i deildir. nc teori ise hcrelem e-sinsitial (cellularisationsyncytial) teorisidir. Bu teoriye gre, tekhcreli bir canl i yapsnda gelitirdii zar yapsyla okhcreli hale gel m itir. Basite sylersek, tekhcreli canl kendi ierisinde odalar oluturm utur. Her b ir blnm e iin hcre ekir deinin de b ir kopyas oluturulm utur. G enel olarak bilim insanlar arasnda, k olon i olutur mu ve sim biyosis benzeri b ir iliki iinde yaayan orga nizm alarn okhcreli organizm alar oluturduu fikri daha ok kabul grm ektedir.

Mikobakteri

(D e lik lile r ) M e th a n o s arc in a IA R K E A IA R I

ekil 89. okhcreliliin ortaya kt

bu hcreler ortak bir genom yapsna sahip organizm alar. tir. T ek h ereli organizm alardan o k h creli organizm ala ra nasl g eild ii konu su bilim in san lar arasnda uzun zam andr tartlan b ir kon u d ur. A ratrm alara gre o k h crelilik dnya zerinde bird en o k defa ortaya k m tr. Burada an latlm ak isten en udur: T ek h creli organizm alardan o k h creli b ir can l oluup daha so n ra gelen tm k arm ak organizm alar da bu canldan t rem em itir. B u nu n yerine b itk ile r, hayvanlar ya da m antarlar (fu n gu s) iin o k h crelilik birbirin d en ayr g elim itir. F ark l tek h creli organizm alardan farkl zam anlarda o k h crelili e geiler m eydana gelm itir. Bugn bile o k h creli yaam a gei yapan tek h cre li organizm alar bu lu nabilir. Evrim b ilim ci Jo h n Tyler B o n n er o k h crelilik grnen organizm alar g sterir ken b ir soyaacm dan faydalanyor. Bu ekild e tekh crelilerden ayr olarak o k h crelilik grnen organizm a lar ve birb irleri arasnd aki akrabalk ilik ileri de ayrt ed ilebilir. (ek il 8 9 )

okhcrelilik ne zaman ortaya kt?


okhcreliliin ilk defa ne zaman ve hangi organiz mada baladn kesin olarak sylem ek ok kolay deil. Siyanobakterilerde okhcrelilie geiin 3 ,5 milyar yl kadar nceye gittii dnlyorsa da, hayvanlarda o k hcrelilie gei ok daha sonralar olm utur. 1,7 milyar yl ncesinden kalm a B an g iom orp h a pu bescen s olarak ad landrlan b ir tr krm z alg fosili, b elirli bir ekilde fark llam hcrelere sahip eeyli reyen en eski organizm a fosilidir. (ekil 9 0 ) 1,4 m ilyar yllk m antar fosilleri ve 1,5 m ilyar ve 9 0 0 m ilyon yllk, H o rod iska ad verilen ve yk sek ihtim alle hayvanlar lem ine dahil edilebilecek orga nizm a fosilleri elde edilm itir.

okhcreliliin ortaya kyla ilgili hipotezler


G enel kabul gren hipotezlere gre okh crelilik, ayn ya da farkl trden hcreler arasnda oluan bir tr sim biyotik (karlkl faydaya dayanan ortaklk) iliki sonucu ortaya km tr. Bu hcreler belirli bir zaman sonunda, tek balarna yaam larn devam ettirem ez hale gelm itir.

15 2

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

153

okhcrelilie geiin getirdii avantajlar nelerdir?


okhcreliliin ortaya km as sonucu tekh cre li organizmalara kar baz avantajl durum lar ortaya km tr. H creler birlikte hareket ederek avclara kar daha dayankl hale gelm itir, bulunduklar ortamda kati bir yzeye daha yi tutunabilm i ye akm tlya karl dayamkh olJ .. .

lk okhcreli organizmalara rnekler


Bu ksm da vereciim iz baz rnekler okhcrelilie nasl geildii zerine fikir verebilir. V olvocine algleri (su yosunlar) fotosentez yapan kam l organizm alardr ve farkl organizasyon yaplaryla tekhcreli ve o k h c reli trler olutururlar. T ekh creli (i.e. C h lam y d om on as ) , hcre farkllam as geirm em i okhcreli ( G onium ve E u d orin a ; 8 -3 2 h cre), hcre dngs (G -S farkllam as) tam am lanm am okhcreli ( P leo d orin a ; 6 4 -1 2 8 hcre) ya da hcre dngs tam am lanm okhcreli rnekleri (Volvox; 5 0 0 -5 0 .0 0 0 hcre) bulunur. V olvox ta blnm e sonucu oluan hcreler jelim si bir yapyla bir arada tutu larak k oloni oluturulur. Hcre says 5 0 .0 0 0 e kabilir. (ekil 9 1 ) Baka bir rnek de P ediastrum ; hcre blnm esi son u cu oluan hcreler ana hcrenin yaknnda bir veziklkesecik ierisinde kalr. Gruptan ayrlp yzebilen h c reler bir sre sonra tek balarna yzebilm e zelliini kaybedip ana grupla tam am en birleir. (ekil 9 2 )
ekil 91 . Volvocine alg rnekleri hcre saysnda, karmaklkta, hcre d sv m iktarnda ve farkl grevlendirilm i hcre tiplerinde ok eitlilik gsterir. A) C hlam ydom onas reinhardtii, B) G onium pectorale, C) Eudorina elegans, D) Pleodorina californica, E) Volvox carteri, F) Volvox aureus. D, E ve F'de iki farkl hcre bulunur. Kk hcreler ksr som atik (vcut) hcreleri, byk hcreler ise reme hcreleridir.

ekil 90. 1,2 m ilyar yllk


Bangiom orpha p u bescens fosilleri. Soldaki rnein en alttaki hcreleri kat bir yzeye yapabilm ek iin zellemi. Sadaki rnekte de, stteki hcreler farkl disk yaplar oluturmu ve zellemiler.

m ulardr, su yzeyine daha yakm a gelerek gne n dan yararlanabilm ilerdir, oluturduklar i ortam saye sinde d ortam a kar dayankl hale gelm ilerdir. ok h creli organizmalarda farkl hcrelerin farkl grevler iin zellem esi, organizm ann btn asndan faydal dr. Bylece kimyasal reaksiyonlar belirli bir dzen iinde ve daha hzl bir ekilde gerekletirilecektir. Tekhcrelilikten okhcrelilie gei konusunda Ric hard Dawkins unlar ne srmektedir: Genleri bir nesilden sonrakine en etkili ekilde aktarmann yolu, eey hcrele rinin (bir sonraki nesile genetik bilgiyi aktaracak yumurta ya da sperm gibi hcreler) gvende tutulabilecei karmak bir vcut yaps oluturmaktr. Bu yzden cle okhcreli bir yap oluturmak organizma iin yararl olacaktr. Jo h n Tyler Bonner da benzer grlere sahiptir: okhcrelilie geite kilit noktann, vcut boyutunun artmas olduu nu sylemektedir. Bu ekilde organizmann genlerini d ortam n etkilerinden korum ak daha kolay olacaktr. Ayn ekilde okhcrelilik, farkl hcrelerin farkl grevler iin zellemesine de olanak verecektir. Bonner farkl olarak ise, ilk bata hcre boyutunda meydana gelen bymenin nedeninin blnmeyi engelleyen bir mutasyon olabilecei ni sylyor. Hcre boyutunun bym esinin getirdii avan tajlarn ise daha sonra geldiini dnyor.

154

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

155

Yukardaki rneklerde o l duu gibi, yeil algler o k hcreli yaayarak daha iyi yakalam ay hedeflerler. Bu yzden o k farkl ekiller oluturabilirler. Siyanobakteriler de o unlukla okhcrelidir. iz
ekil 92. Pediastrum 'ta hcre
blnmesi sonucu oluan hcreler ana hcre tarafndan bir kesecikle sarlr.

gisel filam ent (ipliksi) yap lar gelitirirler. Bu yaplarda meydana gelen dallanmalarla dayankl bir yap oluturur lar. I kullanarak fotosen-

ekil 94. C a n lla r ana gruba ayrlabilir: Bakteriler, arkealar ve


karyotlar.

tez yaparlar ve baz hcrele ri (heterocyst) havadan azot balam ak iin zellem itir. (ekil 9 3 )

I karyotlar O I nasl ortaya kmtr?

3. Blmde (6. ve 7. Sorularda) canllann nasl smflandnldgmdan bahsetmitik. Geni olarak kabul gren snf landrma yntemine gre, canllar temel olarak ana gruba aynlmaktadr. Bu gruplar arkealar, bakteriler ve karyotlardr. (ekil 94) Arkealar ve bakteri ler aynca prokaryotlar olarak adlandrlmaktadr. Prokaryot Yunancada ekirdek ncesi anlamna gelirken, karyot ise gerek ekirdek anlamnda dr. Arkealarda ve bakterilerde zarla evrili belirli bir ekirdek bulunmamaktadr. evremize baktm zda gzle grebildiimiz her canl
ekil 93. Siyonobakteride hcreler birok karyotik hcre kadar byktr. ounlukla okhcrelidir ve izgisel ya da da ll filam entler olutururlar.

(hayvanlar, b itkiler ve tabii ki insanlar) karyot grubun dadr. Prokaryotik hcrelerden daha karm ak yapdadr lar, tem el farklar zarla evrili ekirdekleri ve organellerinin bulunm asdr. Prokaryot hcrelere rnek olarak bir bakteri olan E sch erich ia co liy i gsterebiliriz. Bu hcreler zarla evrili bir ekirdek yapsna ya da organellere sahip deildir. Tm reaksiyonlar hcrenin i ortam nda, yani sitoplazm asm da meydana gelirken; bir karyot h cresin de, rnein hayvan ya da bitk i hcrelerinde, reaksiyon larn byk ounluu organellerde (b ir evin odalarna benzetebiliriz) meydana gelir. (ekil 9 5 ) karyotlann yapsnda bulunan nemli organellerden birisi mitokondridir. Bu organeller hcre iin gerekli enerji nin retildii yerler olduundan son derece nemlidir; ayn ca karyotik hcrelerin ilk defa nasl ortaya kt zerine ortaya atlan teorilerde de ok nemli rol oynamlardr.

ekil 95. Solda tipik bir prokaryotik hcre; sada ise ekirdek ve organelleriyle karyotik hcre grlyor.

15 6

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

157

karyotlar ne zaman ortaya kt?


Fosil kaytlarna gre canlln dnya zerinde yakla k 3,5 milyar yl nce ortaya ktn sylem itik, ilk 1,5 milyar yl boyunca dnya zerinde sadece prokaryotlar yaamtr. karyotlarm ilk ortaya k, kesin olarak syleyem esek de, yaklak 2 milyar yl ncesinde olm utur. Arada geen yaklak 1,5 milyar yllk srede yaam ve prokaryot ile karyot arasnda gei hcresi olan bir orga nizm a henz bulunabilm i deildir. Bu dnem hakkm daki bilgilerim izin ounu gnmzde yaayan prokaryot ve karyot hcreleri alarak elde ediyoruz. zellikle son 2 0 yl ierisinde hcrelerin yaplarnn ve genom larnn aratrlm as sonucu, prokaryotlardan karyotlara geiin nasl olduu hakknda daha ok bilgi edindik. karyotik hcrenin ortaya k, canlln tarihindeki en nem li dnm lerden birisidir. Bunun nedeni, daha sonralar ortaya kacak olan okhcreli canllarn kar yot hcrelerden tremi olmasdr.

ekibi canllar, karyot lar, bakteriler ve arkealar (arkebakteri) olarak temel grup altnda isim lendirdi. Bu snflandr m ann tem elinde yatan fikir, benzer genetik yap daki organizm alarn b ir birine daha yakn akraba olduklaryd. ok nem li hcresinden byk olan dierini hcre bir baka sonu da, kar iine alyor, ancak onu sindirmek yotlarm kendi arasnda yerine karlkl avantaja dayal benzerlik gsterm esi, an simbiyotik bir yaama geiyorlar. Altta, byk bakteri blnp oaldka cak prokaryotlarla b en kk olan da blnerek oalyor ve zerliklerinin o k daha az bu durum yeni hcrelerde de devam olmasyd. Sonu olarak ediyor. W oese ve ekibi, karyot larm prokaryotlarn devam eklinde deil, daha farkl bir ekilde evrilmi olduu sonucuna ulam t. M assachusetts niversitesinden mikrobiyolog Lynn Margulisin ise ok farkl bir hipotezi vard: karyotik hc relerin ortaya k zerine en geni kabul gren bu hipo tez birok deneysel almayla desteklenmi ve endosimbiyotik teori adm almtr. Teorinin temelinde, karyotik hcrelerden nce yaam prokaryotik hcrelerin birlikte yaad dncesi yatyordu. karyotik hcreler bir za manlar ayr olarak yaam, ancak daha sonra bir araya gel mi prokaryotik hcrelerden tremilerdi. karyotlarm ya psnda bulunan mitokondritl0) daha nceleri kendi halinde yaayan bir bakteriydi ve daha byk bir bakteri tarafndan yutuldu; ancak paralanmak yerine iki bakteri birlikte ya amaya baladlar. Bu karlkl yarara dayanan bir ilikiydi. M itokondriyi oluturacak olan hcre, byk hcre tarafn dan korunuyor ve gerekli besini salanyordu. Byk hcre ise kk hcrenin rettii enerjiden yararlanyordu. Bu tr bir iliki her iki hcrenin de iine yaryordu. (ekil 96)
e k i l 9 6 . stte, iki farkl bakteri
1 0 )M ito k o n d r i: k a ry o l h c re le rd e b u lu n a n ve o k s ije n li s o lu n u m ile e n e rji re tim in in g e re k le ti i o rg a n e l, k sm d r.

karyotlar nasl ortaya km olabilir?


Peki nasl oldu da bu derece karm ak yapdaki karyodk hcreler ortaya kabildi? Bilim insanlar uzun za m andr bu sorunun cevabn bulm ak iin alm aya de vam ediyor. 19 7 0 li yllara gelinceye kadar, bilim insanlar canllar temel olarak prokaryot ve karyot olm ak zere ikiye ayryordu; ancak daha gelimi yapdaki karyotla rm prokaryotlardan m evrildii yoksa bunlarn ortak bir atadan evrilerek farkl kollarda m ilerledii bilinm iyordu. Canllarn snflandrlm as konusundaki en nem li geli m elerden biri, 1 9 7 0 li yllarda Illinois niversitesi aratr m aclarndan Cari W oesedan geldi. W oese ve ekibi birok farkl organizmada 16S rRNA ad verilen RNA dizilerini inceledi ve benzerliklerine gre canllar snflandrd. Bu snflandrm adaki en nemli bulgulardan birisi prokaryotlarm iki temel gruba ayrlm olduuydu. B ir grup E. coli gibi daha bilind ik bakterileri ierirken, dier grupta yksek scaklk, oksijensiz blgeler gibi ar ortamlarda yaayabilen organizm alar vard. Bunun zerine W oese ve

158

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

159

ekil 97. M ltokondri ve kloroplast, b ir zam anlar yaam farkl bakterilerin simblyotik yaam sonucu ortaya kmtr.

M itokondrinin yapsna baktmzda, bakterilerle ok benzerlik gsterdiini grebiliyoruz. Zar yaplar, enerji retme ekilleri benziyor. M itokondri de kendi DNAsma sahiptir ve hcre blnrken m itokondri DNAsn o altarak yeni hcreye aktarr. M itokondri DNAs bakteri DNAsna benzer, ancak karyot DNAsna benzemez. M i tokondri iinde grev yapan baz proteinlerin genleri kar yot hcrelerin DNAsna yerlemitir. Bu genlere yksek benzerlik gsteren genler de, karyot genlerinden deil prokaryot genleri arasndan km tr. Bu genler yksek ih timalle, hcreler birletikten sonra m itokondri DNAsmdan koparak ekirdek DNAsma eklenmi olmaldr. M itokondri iin geerli olan durum kloroplastlartn) iin de geerlidir. Benzer ekilde kloroplastlarn da simbiyotik bir bakteriden tredii dnlm ektedir. K lo roplast da prokaryotik hcrede olduu gibi kendi hcre zarna ve DNAsma sahiptir ve hcre oalrken bu DNA karyot hcrenin kendi DNAsmdan ayr olarak kopyala narak oaltlr ve yeni hcrenin kloroplastnm DNAs olarak grev yapar. M itokondriler tm karyotlarda bulunur, ancak kloroplastlar tm karyotlarda bulunm az. lk bata m itokondri hcre iinde yerlem i olm aldr ve daha sonra ayn yolu izleyen kloroplast baz karyotlar iinde yaamaya bala m ve bitkilere giden yolu am tr. (ekil 97)
11) K lo ro p last: B itk i h c re le rin d e v e b a z d i er k a r y o tik h c re le rd e b u lu n a n ve fo to se n te z in y a p ld o rg a n e l, k sm d r.

ekil 98. M itoko ndri, tifo bakterisi, kloroplast ve siyanobakterl D N A'larnn filogenetik analizi endosim biyotik teoriyi destekliyor.

E ndosim biyotik teoriyi destekleyen en nem li ka ntlar, organizm alarn genetik m ateryalinden gelm itir: 1 9 7 0 li yllarda Cari W oese ve Ford D oolitle su yosun larnda bulunan kloroplastlarn DNAs zerine alt lar. Elde edilen sonulara gre kloroplast DNAs alglerin DNAs ile ok az bir benzerlik gsteriyordu, ancak siyanobakteri DNAs ile ok daha yksek bir benzerlik gs teriyordu. M itokondriler iin de benzer bir durum vardr. M itokondri DNAs da tifoya neden olan bakteri DNAs ile daha yksek bir benzerlik gsterm ektedir. Buradan karlan sonu, siyanobakterilerin atalarnn kloroplast oluturan hcreler olabilecei ve ayn ekilde de tifoya n e den olan bakterilerin de bir zam anlar m itokondriyi olu turan hcreler olduklardr. (ekil 9 8 ) karyotlarm tam olarak nasl ortaya kt zerine farkl fikirler olsa da, nem li olan karyotlarm ortaya kn n biyolojik bir devrim olduudur. Prokaryotlarn en erji retebilm ek iin kullandklar tek yol ykl atom lar zarlarndan pom palam aktr. Bu da hcre bykly le snrlanr. Prokaryotlar boyut olarak bydke, hacim art yzey alan artndan daha hzl gerekleir. Sonu olarak da retilen enerji byyen hcre iin yetersiz ka lacaktr. karyotlar ise yaplarnda bulunan yzlerce m itokondri yardmyla en erji sorunu yaamazlar. Farkl boyutlara ve yeni ek o lo jik eitlere evrilebilirler. Bu y o l

160

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

161

la da tekh creli karyotlardan okhcrelilere, zellemi yaplara giden yol alm olur.

" T I Fotosentezin evrimi / I dnyadaki yaam nasl etkilemitir?


Fotosentez gezegende gerekleen en nem li biyolojik

srelerden biridir. Dnya zerindeki karbonun tam am na yaknn retm esinin yannda, atm osferde oksijenin artm asna yol aarak gezegenin bugnk halini almasnda da nem li rol alm tr. O rganizm alarn ilk defa ne zaman gne enerjisini k u l lanmaya balad aratrlmaya devam edilen bir kon u dur. A ncak birok bilim insan, fotosentezin yaam ortaya ktktan ksa bir sre sonra ortaya ktn ne srm ek tedir (3,5 milyar yl kadar nce). Gnmzde fotosentez yapan organizm alarn ou ok sijen ve elektron (hid rojen) kayna olarak suyu kullanr ken, ilk defa gne n kullanan hcreler daha farkl kaynaklar kullanm olmallar. Bunun temel nedeni ilk atm osferin ve okyanuslarn oksijen bakm ndan ok fakir olm asdr. Fotosentez, oksijensiz ve oksijenik olm ak zere tem el de ikiye ayrlabilir. lk fotosentez tr oksijensiz foto sentezdi. Bu yolu kullanan organizmalara m or ve yeil k k rt bakterilerini rnek olarak verebiliriz. Elektron kayna olarak H2S ya da H2 kullanlrken, darya oksi je n verilmez. Atm osferin ve ozon tabakasnn gnmz eklini almas ise daha sonra geliecek olan o ksijen li foto sentezin evrilmesiyle m m kn oldu. M or ve yeil kkrt bakterileri, k enerjisini srad kullanm a yollaryla, fotosentezin ve hcresel enerji m e tabolizm asnn evrim inin anlalm as asndan olduka nem lidir. O ksijensiz ortamda fotosentez yapabilm ele ri evrimsel adan zellikle nem lidir, nk ilk Dnya

atm osferinde ok az m iktarda oksijen bulunuyordu. Bu yzden bilim insanlar bu bakterilerin ilk fotosentetik or ganizmalar olduunu ne srm ektedir. G enetik alm a larla da m or ve yeil kkrt bakterilerinin ilk fotosentetik organizm alar olduu desteklenm itir. ounlukla o ksi jen in az olduu, ancak indirgenm i kkrt bileiklerinin youn bulunduu sularda bulunan yeil kkrt bakteri sinin gen yaps incelendiinde de fotosentezle ilgili ok sayda gen ortaya karlm tr. Dier yandan, oksijen ik fotosentez ise elektron kay na olarak suyun kullanld ve darya oksijenin veril dii bir ilem dir. Siyanobakteriler, su yosunlar (algler) ve bitkiler bu yolla enerji retir.

Oksijen felaketi
D nyan m ilk atm osferin d e o k sijen m ik ta r o k azd ve ilk organizm alar da o k sijen siz ortam da yaam a ya alm t. A ncak siy an o b ak terilerin atas, h id ro jen (elek tro n ) kayna olarak suyu k u lla n a b ilin ce, darya ca n llar iin to k sik o la b ilecek o k sije n i de salm aya b a lad. J e o lo jik kaytlar bu d n m n en az 2 ,4 m ilyar yl n ce g erek leti in i gsterse de, o k daha n celeri de olabilir. A rkean D n em inden kalan stro m a to litler zerinde 3 ,5 m ilyar y llk siy an o b ak teri fo silleri bu lu nm utu. (ek il 9 9 ) A ncak o k sije n li fo to sen teze ne zam an ge ild ii k esin b ilin m iy or. G nm zd en 2 ,4 m ilyar yl n cesin d en itib aren 5 0 -1 0 0 m ily on yl ierisin d e atekil 99. Soldan saa filam ent halindeki siyanobakteriler, siyanobakteri fosillerinin birikmesiyle oluan strom atolitler ve siyanobakteri fosil rnekleri.

162

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKI)

163

Ancak belirli bir zaman sonra oksijen arttka, atmos ferde ve sularda demirin tutabileceinden daha fazla ok sijen birikmi oldu. Artk canllar iin tehlike balyordu. ou organizma ksa srede yok oldu, bir ksm organiz ma oksijensiz ortamda yaamaya devam etti, bir ksm or ganizma ise bamsz olarak oksijenli solunumu gerek letirmeye balad. Oksijenli solunuma gei Hcresel solunumun ilk hali byk ihtimalle fermentasyondu. Glikoliz her hcrede meydana gelen temel bir yntem olsa da, daha basit bir ekli ilk balarda ortaya km ve zamanla da gelimi olmal, ilk hcreler byk ihtimalle organik molekllerden enerji elde etmeye ba lamadan nce, inorganik molekllerden enerji elde edi yorlard. Oksijenli solunum ise ok daha yeni bir gelime ol mal. lk atmosferde oksijen bulunmadndan, ilk bata fotosentez gelierek atmosfere oksijen salnm ve deva mnda da oksijenli solunumun gelimi olmas mantkl grnyor. Mor bakteri, elektron tama sistemlerin de deiiklik yaparak oksijeni kullanmay renmi ve bylece karyotlarm aerobik (oksijeni kullanan) olma larnn da yolunu am olmal. karyotlarda bulunan mitokondri organeli solunumun gerekletii yer halini alrken, sonraki nesillerden bazlar bamsz olarak kloroplast yaplarna kattklarnda, karyotik bitkilerin de yolu alm oldu. Oksijenli solunumun salad en nemli avantaj, elde edilen enerji miktarnn oksijensiz solunuma oranla ok daha fazla olmasdr. Tekhcreli yaam formlarndan de vasa ve hareketli canllara gei, oksijenli solunumla sa lanan enerjiyle mmkn oldu.

3,5

2,5

1,5

0,5

Milyar yl nce

ekil 100. Atmosferdeki oksijen miktarnn gnmz oranlarna gelii.

mosferdeki oksijen miktarnda art gerekleti. Benzer ekilde okyanuslardaki znm oksijen miktar da artmaya balad. Oksijen miktarndaki bu arta oksi jen felaketi ad verilir. Bunun nedeni de, imdi bizim iin vazgeilmez olan oksijenin, o dnemdek. canllar iin zehirli bir gaz oluuydu. Oksijen ok iyi bir elekt ron tutucudur, bu yzden canllar iin ok tehlikeli olabilir. Oksijenin yaylmasyla birlikte organizmalar yaam larn devam ettirip ettirememe konusunda ok nemli bir testle kar karya kald. Oksijeni kullanabilecek leri sistemleri gelitiren organizmalar yaama devam ederken, birok bakteri ksa srede yok oldu. (ekil

100)

tik balarda ortama sal- dnemde( deniz dip| erinde 0| u5an nan oksijen, denizlerde yk- demiroksit tabakalar, sek miktarda bulunan demi ri oksitliyor ve kyordu. Deniz yataklarnda bulunan km demir tabakalar bu srecin kantlandr. Bu d 1 nemde Dnya paslanyordu denilebilir. (ekil 101)

ekil 1 0 1 . "Dnyann pasland

164

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

165

*3 Q DO

Ozon tabakas nasl ortaya kmtr ve canlln gelimesi asndan nemi nedir?

Bir nceki soruda atm osferdeki serbest oksijen in nasl ortaya ktn ve milyarlarca yllk bir zaman sonunda bugnk seviyeye nasl geldiini anlatm tk. Canlln gelim esi ve eitlenm esi asndan son derece nem li olan oksijen in tem el kaynann yine canllarn yapt o ksijenli fotosentez olduunu grm tk. imdi de at m osferdeki oksijenin artnn bir sonucu olarak ortaya kan ve canlln devam iin hayati nem tayan ozon tabakasndan bahsedelim . O zon nedir, canllk iin neden bu kadar nem lidir ve ozon tabakasnn u andaki duru mu nedir?

lunurken, kutuplardaki tabaka daha kalndr. Tropik b l gelerde gne ile birlikte ozon retim i daha fazla olsa da, retilen bu ozon kutuplara doru tanr. Ayn ek il de mevsim lerle de deiiklik gsterir. Kuzey yarkrede baharda daha kaim ken, sonbaharda daha incedir. Bunun nedenleri gne nn younluu ve atm osferik sirk lasyondur.

Ozon nedir? Atmosferdeki dalm nasldr?


O zon oksijen atom undan oluan bir gazdr ( 0 3). Dnya zerinde canlln devam iin vazgeilm ez bir arttr. G neten gelen yksek en erjili ve canllar iin za rarl olan UV (ultraviyole-m or tesi) nlarn engelleye rek Dnya yzeyini canllar iin yaanabilir bir yer haline getirir. Atmosferde bulunan toplam ozon m iktar 3 milyar ton civarndadr, ancak bu oran atm osferin sadece yz de 0 ,0 0 0 6 sm oluturur. O zon atm osferde yzde olarak bu kadar az oranda olsa bile, zararl UV nlarna kar bir barikat oluturmaya yeterlidir. Bu m iktarn yzde 9 0 stratosfer tabakasnda, yani yerden 10 -5 0 km ykseklikler arasnda yer alr. Stratosferde bulunan ozon m iktar doal sreler sonucu dengelenm itir. Ozonu oluturan ve par alayan reaksiyonlar birbirini dengeler ve ozon m iktar sabit kalr. A ncak insan aktiviteleri nedeniyle bu denge s rekli olarak bozulm aktadr. D nyay evreleyen sabit b ir ozon tabakasndan b ah setm ek m m kn deildir. Bunun yerine deiken, atm os ferde hareket halinde olan, m evsimlere ve blgelere gre farkllk gsteren bir tabaka olduunu bilm eliyiz. G enel olarak ekvator civarnda daha ince bir ozon tabakas bu-

Atmosferde ozon nasl oluur?


Ozon ( 0 3), havaya salnan serbest oksijenin ( 0 2) gne yla paralanarak oksijen atomlarna ayrlmas ve deva mnda da oksijen atom unun ya da bir oksijen atomu ile bir 0 2 m oleklnn birlemesiyle oluur. (ekil 102) Gnm zden yaklak 2 ,3 milyar yl nce, atm osferde oksijen m iktar artmaya balaynca, b ir ozon tabakas da olum aya balam olmal. UV n n n kesilm eye bala masyla, okyanuslarda yaayan karyotik b itk isel plank ton m iktarnda hzl bir art yaanm olm as m m kn.

Ozon tabakas nasl korur?


zellikle stratosferde bulunan ozon tabakas, G neten gelen farkl UV nn farkl m iktarlarda engelleyerek, canllar iin korunak salar. UV-A (4 0 0 -3 1 5 n m ), UV-B (3 1 5 -2 8 0 nm ) ve UV-C (2 8 0 -1 0 0 nm ) nlar farkl dalga boylarnda ve farkl enerjilerde nlardr. zellikle UVC nlar, yksek enerjisinden dolay canllar iin tehlike oluturacaktr. Ozon tabakas UV-C nlarnn tam amn, UV-B nlarnn byk ounluunu ve UV-A nlarnn da yarsn durdurarak, Dnya yzeyine ulam alarn en geller.

166

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

167

CI + O 3 ----- CIO + 0 2 CIO + O , > 2 0 , + CI T L * ...


ekil 103. Klor atom u (Cl) zincirleme reaksiyonlarla binlerce ozon
m oleklnn paralanm asna neden olabilir.

Ozon tabakas nasl paralanr?


Ozon tabakas atm osferde oluan azotoksit (n itrik ve nitrozoksit, N O , N 0 2), hidroksil (O H ), klor (C l) ve brom (Br) gibi serbest radikallerle tepkim eye girerek paralanr. Bu kim yasallar doal olarak retilse de, insanlar tarafn dan yksek m iktarlarda retilen organohalojen bileikler [zellikle kloroflorokarbon (C F C ) ve brom oflorokarbon] ozon paralanm asnn asl sorum lulardr. Bu bileikler son derece dayankldr ve stratosfere ykselerek gne sayesinde atom lara ayrlrlar. Serbest kalan Cl ve Br radikalleri 1 0 0 .0 0 0 ozonu paralayabilecek bir zincir re aksiyon balatr. (ekil 103) O zon paralandka gne n tutma zellii azalr ve Dnya yzeyine daha fazla gne n gelir.

m i ile llr; bir dobson birim i 0 C ve 1 atm b a snta 0 ,01 mm kalnlkta bir tabaka oluturm ak iin gerekli ozon miktardr. Dnya yzeyindeki ozon her tarafa eit dalmasa da, ortalama olarak 3 0 0 dobson birim lik (sk trldm da 3 m m ) ozon ekil 104. A ntartika zerindeki ozon tabakas bulunur. deliinin Eyll 2 0 1 0 'd a k i durum unu Herkes tarafndan b ili gsteren Toplam O zon lm nen ozon delii Antartika Spektrometre (TOMS) grnts. zerinde, gney yarkre n in bahar aylarnda (A ustos-Ekim ) meydana gelen in cel m edir. Burada ozon m iktar 100 dobsona kadar dm ek tedir. (ekil 104, 105) G enel olarak, kuzey yarkredeki ozon m iktarnda her 10 ylda yzde 4 lk bir azalma grlyor. Tm dnya yzeyinde ise, zellikle kuzey ve gney kutuplarnda o l m ak zere yzde 5lik bir azalma yaanyor. Antartika zerindeki ozon tabakasnn incelm esi ilk defa 1 9 8 0 lerin balarnda gzlemlendi. Uluslararas ibirliiyle 1 9 8 7 de imzalanan M ontreal Protokol ile ozon tabakasn
ekil 105. O zon deliinin ortalam a bykl. l m le r 1 9 7 9 -2 0 1 0 yllar arasnda, Eyll-Ekim aylar arasnda alnmtr.

UV nlarnn ne gibi zararlar olabilir?


UV-B ve UV-A nlar U V -C nlarna oranla daha az zararl olsa da, bu nlara da uzun sre maruz kalm ak gne yanklarna, deri kanserine ve gzde zarara neden olacaktr. Bunun yannda biyoeitlilik zerine de nem li etkileri vardr. Artan UV-B nlar okyanuslardaki plank ton m iktarnn azalm asna neden olur. Balklar bu azal m adan dorudan etkilenecektir. Benzer ekilde, bitkilerin bym elerinde de olum suz etki oluturacaktr. Bu da ta rm sal verim liliin azalm as dem ektir.

Ozon tabakasnn durumu ve ozon delikleri


O zon delii denildiinde, sz edilen atm osferde hi ozon bulunm ayan b ir blge deildir. O zon m iktarnn 2 0 0 dobson birim den daha dk olduu bir blgeden sz edilm ektedir. O zon m iktar genel olarak dobson b iri-

168

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

169

incelten maddelerin [Cl, Br, F ierikli- zellikle kloroflorokarbon (C F C ) ve brom oflorokarbon] retimi ve kullan mnda kstlamaya gidildi. Bugn dnya apnda 196 lke protokol imzalam durumda. Bu gazlarn yasaklanmas sadece ozon deliini kltm eyi amalamyor. Ancak, 2 0 0 0 lerin balarnda ozon deliinde klm e gzlemlense de, son yllardaki lm ler ozon deliinin klm esi nin durduunu ve tam olarak kendini tamir etm esinin 50 yldan daha uzun zaman alacam gsteriyor. Bu yzden daha farkl, yeni uygulamalarla bu sorunun zmn ara malyz.

Q I Kambriyen Patlamas adlandrmas D y l n e anlatr?


Dnyanm yaklak 4,5 milyar yanda olduundan ve ilk canl hcrelerin 3 ,5 -3 ,8 milyar yl nce ortaya ktn dan imdiye dek pek ok kez sz ettik. lk organizm alar dan sonra gelen 1,6 milyar yl boyunca, karyotlar ortaya kncaya kadar, tm organizm alar basit yapda prokaryot hcrelerdi. Gnm zden yaklak 2 milyar yl nce karyot hcreler ortaya ktnda hcre yaps daha kar m aklat, ancak organizm alar hl tekhcreliydi ya da hcre kolonileri halinde yayorlard. Bu durum yaklak 1,4 m ilyar yl boyunca, daha karm ak yapdaki okhcreli Ediacara form larnn ortaya km asna kadar devam etti. Buraya kadar sylediklerim izi bir araya getirdiim iz de, yaamn dnya zerinde bulunduu ilk 3 milyar yl boyunca, evrimin bakteri, plankton ve okh creli algler dnda ok fazla eitlilikte organizmaya yol am adm syleyebiliriz. A ncak gnm zden yaklak 5 4 3 -4 9 0 my (zellikle 5 4 3 -5 4 2 m y), grece olarak ksa b ir zaman dilim inde canl eitliliinde ok hzl bir art yaand. Kam briyen Patlam as" ad verilen bu olayda, saysz yeni canl tr ortaya karak dnyaya yayld.

Kam briyen Patlamas canllk tarihi asndan ok nem li bir yere sahiptir, nk hayvanlar lem inin nem li kollarnn ou fosil kaytlarnda ilk defa bu dnemde ortaya ktlar. (ekil 106) Canl eitliliindeki ilk art, Ediacara Faunas can llarnda grlyordu (6 3 5 -5 4 2 m y), bu Kam briyen D nem inden ncesine rastlyordu. Bu dnem de ortaya kan canllardan bir ksm gnm ze kadar devam eden organizm alarla balantlyken, bir ksm daha sonra or tadan kayboldu. A ncak Kam briyen D nem i ile birlikte, canl eitliliinde meydana gelen hzl art o zamana k a dar grlm em i bir seviyeye ulat. Bu dnem deki canl eitlilii artm Kam briyen Patlam as olarak adlandr yoruz; ama bu adlandrmayla genel olarak, ok hzl bir oluum dan bahsetm iyoruz. zellikle baz kesitlerde canl eitliliindeki art ok hzl olsa da, ncesi ve sonras ile 3 0 -7 0 m ilyon yllk bir sreten sz ediyoruz. G ene de canllarn ilk ortaya kt andan itibaren geen toplam zamana kyasla, bu kadar ksa bir zamanda meydana gelen art patlam a olarak ifade edilebilir.

Kambriyen Dneminden gnmze kalan fosil rnekleri


Kam briyen Patlam as ile ilgili bilgilerim izi, fosil ve je ekil 1 0 6 . H ayvanlar lem inin nem li kollarnn ou Kambriyen D nem i'nde ortaya ksa da, bu dnem de ortaya kan canllarn nemli ksm zaman ierisinde ortadan kalkt ya da nemsizleti.

170

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

171

Elim ize geen fosiller, fosilleebilen ksm lara sahip organizm alardan kalanlar dr. O rganizm alarn, m ilyonlarca yl boyunca toprak al tnda bozulm adan gnm ze kadar gelm esi gerekiyor. Kam briyen D nem ini ve ncesini birbirinden ayran en nem li zellik, nceki dnem den kalan korunm u fosil rneklerinin ok daha az olm asdr. Kam briyen D nem inde ise fosil kaytlarnda hzl bir art yaanm tr. Bu farkn nedeni, Kam briyen ncesi dnemde yaayan organizm alarn fosilleecek ksm lara sahip olm am as ya da zaman ierisinde fosillerinin yok olmasdr. Gene de, 5 7 0 m ilyon yl ncesinden kalm a ufak em briyon fosille rinden sz edebiliriz. O rganizm alarn balkta braktklar ve zaman ierisinde fosilleen izler de bize dolayl yoldan bilgi verir. Kam briyen eitliliin in en iyi rn ek leri Kanadadaki Burgess Sh ale fosil yataklarnda bulunm utur. D n e m in ortalarndan kalan fosiller arasnda m idye benzeri kolsu ayakllar (b rach iop od ), trilobitler, yum uak alar, derisi d ik en liler (ekinod erm ) ve gnm zde o l m ayan b iro k garip grnl hayvan fosili bulunuyor. (ek il 107) rnein, be gzl ve bir yangn hortum una benzeyen burnuyla O pabinia ve zrhl yaps ve iki sra dik duran pullaryla W iw axia dnem in garip grnl hayvanla rndan d. (ekil 108) Bilim insanlar bu tr garip gr nl hayvanlarn snflandrlm asnda zorluk ekseler de, bir ksm nn eklem bacakllara dahil olduklar anla lyor. Ancak O pabin ia gibi hayvanlar bugn yaayan bir gruba dahil etm ek zor grnyor.

ekil 1 0 7 . Kambriyen D nem l'nden kalm a bir H allucigenia (eklembacakl) fosili.

o lo jik kaytlarn bize izin verdii m iktarda elde edebiliyoruz. B il gilerim izin ana kay na fosil kaytlardr. Daha dorusu, gn m ze ulaabilen iyi durum daki fosillerdir.
y - r -

Kambriyen Dneminin evre artlar


8 0 0 -6 0 0 my dnya apnda G e R iphean ve E r ken V en d ian dnem lerinde buzlanm a olm utu, ancak Kam briyen D nem ine gelin irken zorlu k ou llar artk sona eriyordu ve scak lk gnm zde olduundan faz layd. Karasal yap olarak, gnm zden 8 0 0 m y, D n ya zerinde Rodinia adnda tek b ir k ta bulunuyordu. Kam briyen D n em in in balad dnem de ise bu sperk ta paralanarak daha k k ktalara ayrlm aya bala m t. D nem in tem el zelliklerine baktm zda; tm yaa m n sularda olduunu, yaam form larnn ounun k k yaplarda ve ortaya kan hayvanlarn ounun da srad vcut yaplarnda olduunu grrz.

Kambriyen Patlamasnn nedenleri ne olabilir?


Bilim in san lar, bu kadar ksa b ir zaman dilim inde o r taya k an bu derece farkl vcut yaplarnn ned eni o la rak farkl aklam alar getiriyor. n celik le gnm zden 7 0 0 my balayan o k sijen art h areket iin b ir yakt kayna oluturm u ve karm ak vcut yaplarnn o rta ya km asna neden olm u olabilir. D ier bir neden de K am briyen D nem i ncesind e m eydana gelen k itlesel y ok olu son ras, yeni trler iin ek o lo jik bir boluun alm asdr. Bir dier neden de, geliim le ilgili genlerin K am briyen D nem i ncesind e g eird ikleri evrim sel ge lim e olabilir.

ekil 1 0 8 . Kambriyen D nem l'nln garip canllarndan O p a b in ia (solda) ve Wiwaxia (sada).

172

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

173

I Bitkilerin evrimi ve I karalara yaylm nasl gerekleti?


Bitkiler dnya zerinde ortaya ktklar ilk andan g nm ze kadar geen srede ok farkl yaplara ve organi zasyon seviyesine evrim leti. G irdikleri her alana kolayca uyum salayp, baarl oldular. Kara bitk ileri gnm zden 4 5 0 -5 0 0 m y, sularda ya ayan yeil alglerden (su yosu nlarnd an) evrim leti. Su dan karaya gei byk ihtim alle, zam an zaman suyun ekildii s blgelerde yaayan ip liksi, haploid ve dall yapdaki su yosu nlarnn karasal yaama ayak uydurm a syla balad. Zaman iind e gelitirilen m um lu kutikl tabaka ( st tabaka) yaprak larn kuru m asn salarken, gzenekler de (stom ata) gaz m olek llerin in atm osfere g iri-km salad. Spor kullanarak rerken, toh u m lar ve p olenleri gelitirdiler. B ylece rem e h creleri de b ir yandan paralel olarak ev rildi. B itki ilerin d e gelitiri ekil 109. ilk basit karasal bitki len dam arl yaplarla da b e trlerinden C ooksania pertoni fosili. sin ve svnn ierde dolam dzene alnd.

ortaklndan oluuyordu. K f koruyucu bir k lf olu tururken, alg hcreleri kloroplastlarm kullanarak besin retiyordu. Belirli bir kk yapsna sahip deillerdi, ancak kayalar zerinde kolayca byyorlard. Yosunlar da ilk bitkiler arasndayd. Bir araya gelerek kayalar ve dier y zey zerine tutunuyor, suyu bir snger gibi ekiyorlard. Belirli bir damar yapsna sahip deillerdi. Ereltiotlar ise ilk defa damars sistem leri gelitiren bitkilerdi. Bu sayede besin ve sv, bitki ierisinde yaprak lar ve kk arasnda dzenli bir ekilde tamyordu. G er ek anlamda tohum gelitirm ediler, bunun yerine sporla oaldlar. Kurtaya ve k rk k ilit ise damarl yaplara sahip, ancak tohum gelitirmeyen bitkilerdi. (ekil 110) lk bitkilerin yetitii karasal alanlar, im diki gibi top rakla kapl deildi. Bunun yerine daha ok kaya, kum , a m ur ve biraz da kil ieriyordu. Bizim bildiim iz anlamda toprak ise organik bileikler, kaya paralar, m ineraller, canl toprak bakterileri ve protozoalarn (tekhcreli hay vanlar) bir karm dr. Yaayan ok farkl organizmalarla birlikte, lm canl atklarnn da birikim idir. Bitkiler asndan sudan karaya gei olduka avan tajlyd. Daha fazla k vard ve ilk zamanlarda bitkilerle b eslenecek hayvanlar yoktu. G erekli olan m ineral de or tamda m evcuttu. Silriyen (4 2 0 m y) ve Erken Devoniyen D nem lerinde (4 1 0 m ilyon yl ncesinden itibaren) bitki eitliliinde art gzlem lense de, bitki boylan 50 cm in zerine k m am t. iek ve yaprak henz gelim em iti, ancak bir ok bitki inelere sahipti. Bu ineli yaplar, korunma amaekil 110. G nm zden liken ve ereltiotu rnekleri.

Ordovisiyen Dnem sonu, Silriyen ve Devoniyen Dnemleri (450-350 my)


Gzle grlebilen, bilinen en eski karasal bitk i fosille ri yaklak 4 2 5 m ilyon yl ncesinden gnmze ulaan ve C o o k sa n ia ad verilen 3-4 cm boyundaki kk bitk i lerdir. Bu bitkiler spor oluturarak oalyordu; iek ve tohum lar yoktu. (ekil 109) Devam eden 20 -3 0 milyon yl boyunca bu bitkilerin en yaygn bitki trlerinden oldu unu syleyebiliriz. Gnm zde ok eidi bulunan likenler de karada ya ayan ilk bitki trlerindendi. Bu bitk iler algler ile kflerin

174

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

175

l gelitirilmi olmayabilir. nk karalarda bitkiler iin tehlike olu turabilecek bir hayvan eitlilii yoktu. Bunun yerine yzey alann arttrma amal gelitirilmi olabi lir. Sporlu bitkilerdi. Bu dnemin fosil kaytlarndan elde edilen bul gular olduka kstldr. Devoniyen Dnemi ortalarna doru (390 my) birka metre ykseklie ulaabilen kk aa lar ortaya kmaya balad. Kk, yaprak ve odun dokusu gibi temel ekil 111. Dnya'da ortaya kan ilk aalardan olan yaplar bu dnemde geliti. Archaeopteris 18 m'ye kadar Ge Devoniyen Dneminde uzayabiliyordu. ise (350 my) kozalakl aalarn atas olduu dnlen ve 18 mye kadar uzayabilen Arc haeopteris, yaygn olarak grlen aa tryd. (ekil 111) Dnemin sonlarna doru ise ilk tohumlu bitkiler ortaya kmaya balad ve devam eden 100 milyon yl boyunca kendilerine daha ok yer edindiler. Tohumlu bitkiler yayl dka, sporlu bitkileri topran altna doru ittiler.

Ancak dnem sonuna doru souma balayacakt. Bu dnem kmr yatak larn oluturan geni batak lklaryla nldr. (ekil 112) Karbonifer ismi de zellikle Ingilterede bulunan, bu d nemde olumu zengin k mr yataklarndan gelmek tedir. Benzer yataklar Kuzey Avrupa, Asya, Orta Bat ve Dou Amerikada da grlr. Milyonlarca yl boyunca st ste biriken ormanlar, s ve ekil 113. Karbon Dnem'nden basncn etkisiyle gnmze kalma krkkilit (atkuyruu) bitkisi , , , . .... , fO S jlj kadar ulaan kmr madenlerini oluturdu. Dnemin ortalarna doru lman scaklklar grldke, aas ereltiotlarmda da art balamtr. Karbonifer Dnemi sonlarnda, aa benzeri kurta ya ve krkkilit otlar gerilemeye balad. (ekil 113) Bunun nedeni bataklklarn azalmaya ve Dnyanm sou maya balamasyd.

Karbonifer (Karbon) Dneminden Kretase Dnemine kadar (354-144 my)


Karbonifer Dneminde (350-290 my) bitki eitli liinde byk gelij

Tohum geliti, ak tohumlular ortaya kt


Permiyen Dnemi (290-248 my) sonunda meydana gelen kitlesel yok olula birlikte ereltiotu benzeri bitki lerin oluturduu ormanlar, yerlerini Triyas Dneminde (248-206 my) ak tohumlu (gymnosperm) bitkilere b rakt. Ereltiotlar ve yosunlar remek iin suya baml dr. nk sporlar suda hareket eder. Sperm suda yze rek yumurtaya ular ve dller. Dllenen yumurta da spor oluturuncaya kadar nemli tutulmu olur. Ancak karada gelien bitkiler iin su her zaman ulalr olmayabilir. Bu yzden tohumun gelitirilmesi, yeni ortamlara yaylma asndan ok nemli bir admdr. Polenin gelimesi de. tohumun gelimesiyle ayn dne me denk gelir. Polenler byk olaslkla, yzerek yaylan

ekil 112. Karbonifer Dnem bataklklarndaki ormanlar, zamanla st ste birikerek basn ve snn etkisiyle zengin kmr yataklarn oluturacakt.

B l, l l n

nedeni byk OaSlllkla klimin scak

ve nemli olmasyd. Dnya tarihinde hi bir dnemde, Karbon Dneminin ikinci yansnda olduu ka dar aa yeryzn kaplamad. Antartika bile aalarla kaplyd.

176

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

177

sporlara oranla daha avantajl ynleri yznden yayld. Polenler rzgrla tanabilir ve bu ekilde zarar da gr mezler. Tohum ereltiodarnn fosillem i polenleri g nm zden yaklak 3 0 0 m ilyon yl ncesinden itibaren karm za kyor. M odern kozalakl aalarn ilk rn ek leri de, yine bu dnem de ortaya kt.

5 .3

iekli b itk ile r bdskn h a ld e le r S en o / ok Kapal to h u m lu la rn o rta y a k ak

65

to h u m lu la rn g e rile m e si

Erken Kretase Dneminden gnmze


Kretase D nem ine (1 4 4 65 m y) geldiimizde, i ekli bitkiler artk ortadayd. Bitkiler, iekler sayesinde bceklerle ibirlii ierisine girdi. Bcekler iekten n ek tar toplarken polenleri de dier ieklere tad ve by lelikle polenlenm e olasln arttrd. Gnm zde karasal bitkilerin ounluu iekli bitkilerdir. (ekil 114) 110 m ilyon yl nce kapal tohum lu bitkiler (angiosperm ) aniden ortaya karak ya yld ve ak tohum lu bitkilere (gym nosperm ) baskn hale geldiler. Tohum evresine gelitirilen koruyucu k lf b a zen bir kozalak ya da meyve eklini alyordu ve bcekler, baz m em eliler ve kular yoluyla uzak mesafelere tana biliyordu. Hayvanlar ise karlnda besin alyorlard. Bu ibirlii farkl ekil ve renklerde ieklerin ortaya km a sna yol at. 4 0 m ilyon yl n ce son gelien temel bitk i gruplar o t laklar oldu. ok farkl evresel artlar altnda yaam larn srdrebilecek evrim sel deiiklikleri gerekletirdiler ve dnyann birok alanna yaylarak gnmze kadar ula tlar. (izelge 2)

. 150

Atk toh um cu larn b ask n h a le g elii

iu ra sik

K m ro rm a n la rt 290 reltio tla n n n , a t kuyruklarnn ev rim i illk dan ari bitkilerin yaylm as 3 2 0 -3 4 0 lk to h u m lu b itk ile r K arb on ifer P erm yen

390 443 500

ilk d am arl b itk ile r karalarda o rta y a k tlar Deniz a lg le ri yayg n lat lkel d en iz a lgleri g e liti

D evoniyen Siluriyen K am b riyen

ekil 114. G nm zde bitki trlerinin byk ounluu iekli bitkilerden oluuyor. Bitkilerin gelitirdii rengrenk iekler bceklerin dikkatini ekerek polenlerin kolayca yaylmasnn salamtr.

izelge 2: Bitki evrim inin temel basam aklar.

41

Drt ayakllarn (tetrapodlar) evrimi nasl gerekleti?

Okyanuslarda devam eden yaam eitlerinden baz lar, zaman ierisinde karalara doru yaylmaya balam ve yeni ortam koullarna uyum salayabilen yeni canl trleri gelim itir. Bu geilerin en nem lilerinden birisi, om urgallarn (balklarn) sudan karaya geileri ve deva mnda da drt ayakllarn (tetrapod) olum asdr. Evrim sel biyolojinin yzyl akn bir sredir ortaya koyduu bulgular, am fibiler, srngenler, dinozorlar, ku ve m e m elilerin ortak atasnn okyanuslarda ortaya km ilk trlerden birisi olduunu ve gnm zden yaklak 3 7 5 m ilyon yl nce de karasal yaama uyum saladn gs teriyor. Bu gr destekleyen en nem li bululardan birisi 2 0 0 4 de ortaya karlan bir fosil rneidir. Aratrmaclar, Kanadann kuzeylerinde bir adada, bir balk ile drt ayakl

178

50 SORUDA YAAMIN TARH

YKR/YAAMIN ORTAYA IKII

179

bir hayvann arasnda zellikler gsteren yaklak 120 cm uzunluunda bir fosil buldu. Fosil, solunga, pul ve yz gelere sahipti ve byk olaslkla yaamnn byk bir ksm n sular altnda geirmiti. Ama ayn zamanda akci erleri, esnek bir boynu ve dayankl yzge kem ikleri de vard ve bu sayede ok s sularda ya da karada vcudunu destekleyebiliyordu. Kuzey Kanada Inu it dilinde byk taze su bal an lam na gelen T ik ta a lik ad verilen bu hayvann, yaad dnemde nasl bir ortamda bulunduunu gzmzn nne getirebiliriz. Daha nceleri bulunan bitki ve hay van fosilleri bu canlnn yaad ortam hakknda nem li bilgiler veriyor. Yaklak 3 7 5 my, im di Kanadada Nunavut Blgesindeki Ellesm ere Adas olarak bilinen yer, b iro k akarsunun getii geni bir alann parasyd. (e k il 115) Aalar, ereltiotlar ve dier tarihncesi bitkiler akarsularn kysnda byd; bakteri, m antar ve rk l basit hayvanlar iin zengin bir ortam oluturdular. B yk hayvanlar henz kara zerinde yaamyordu, ancak okyanuslar b iro k balk ekil 115. P aleontologlar kutup dairesi trn barndryordu yaknlarnda, Kanada'nn kuzeyinde ve bu trlerin bazlar bulunan N unavut blgesinde bulduklar fosiller iin saatlerce yol alm a k zorunda s tatl su kaynaklarn kaldlar. Yln sadece iki aynda alma da ve bataklklarda ya yapabiliyorlard. Tiktaalik fosillerini, ayan bitki ve hayvan fotora fn sa tarafndaki yzeye km larla besleniyordu. kayalarda buldular. Paleontologlar daha nce baz s su balk larnn fosillerini b u l mutu. Bu balklarn yzgelerindeki k e m ikler, dier balklarn yzgelerindeki kem ik lere gre daha dayank l ve karm akt. Byk ihtim alle, bu ekilde bitki dolu kanallarda kendilerini daha rahat

ekil 1 1 6 . Tiktaaiik'rt sol eli ve sa yzgeleri, iki ara kemii takip eden tek bir st kemie sahiptir (izimlerde altta bulunan geni kemikler). Bunlar daha modern organizm alardaki gibi dirsek ve bilek grevi grr.

ekebiliyorlard. Ayn zamanda, solungalara ek olarak basit ak cierlere de sahiptiler. Paleonto loglar, daha gen tortul kayalar ierisinde, yaam larnn bir k s m n karada geiren balk b en zeri hayvanlarn fosillerini de bulm utu. lk drt ayakllar ola rak bilinen bu hayvanlarn n ve arka yzgeleri deierek, ilkel bacaklara ve su dnda yaama ya uygun dier yaplara benzemilerdir. A ncak paleontologlar henz s su balklaryla ak ci erli hayvanlar arasndaki gei canllarnn fosillerini bulam a-

ekil 117. Tiktaalik, tatl su balklarnn d rt ayakl hayvanlarn su dnda yaamasna imkn salayan adaptasyonlara doru gelitii dnem boyunca yaad, insanlar da iine alan d rt ayakllar (tetrapodlar) Tiktaalik 'in yaad dnem den ksa bir sre sonra yaam olabilir. Tiktaalik 11 de iine alan evrimsel soy, bu grafikteki ana evrimsel soydan dallanan ksa izgilerde grld gibi tkenmi o la b ilir ya da tm modern drt bacakl hayvanlara (tetrapodlara) yol aan evrimsel soyun bir paras olabilir.

Dier tm modern drt \ W Tiktaatik

sSh .
^ y /

j ayakllar (srngnler,
kular ve insanlar da dahil memeliler)

\ \

Panderichthys

Y v
\ \ -fy
\ V /

Tm drt ayakllarn (tetrapod) son ortak atas

Kemikli balk ve drt ayakllarn son ortak atas

YKR/DNOZORLAR DEVR

181

180

50 SORUDA YAAMIN TARH

mlard. T ik ta a lik , ite tam bu aradaki geii gsteren bir gei canlsdr. T iktaalik bir baln birok zelliini tamaya devam ediyordu, ama ayn zamanda da ilk drt ayakllarn (tetrapod) karakteristik zelliklerine sahipti. En nem lisi ise, yzge kem iklerinin kol benzeri bir uzant yapsnda olm a syd. Bu ekilde hayvan yzgelerini hem hareket etmek iin hem de vcuduna destek yapmak iin kullanyordu. (ekil 116) T ik ta a lik in kefi, evrim kuram nn yapt ngrleri dorulamas asndan son derece nem li olm asnn ya nnda, h er yl yaplan ve biyolojik evrim i anlam am z sa layan keiflerden sadece bir tanesidir. D rt ayakllarn son ortak atasnn ortaya kn , za man ierisinde yeni trlerin evrilm esi takip etti. Hem k a rada hem de suda yaayan am fibiler, srngenler, kular ve m em eliler bu ortak atadan geldi. T ik ta a lik ise bu ortak atann balklarla arasndaki gei basam aklarndan biriy di. (ekil 117)

nsanlarn ilgisini en ok hangi ynleri ekiyor, kesin olarak sylem ek zor. Son dnem lerde yaplan sinem a film lerinin de etkisiyle olsa gerek, ulaabild ikleri devasa boyutlar ve avlarn acm aszca paralam alarn ak n lkla izlediim iz kesin. A ncak sahip olduum uz genel fik irler arasnda, tartm asz doru olarak kabul gren dinozorlarn bir felaketle tm yle yok olduu fikri bile yanl olabilir. Elde edilen yeni bulgular, dinozorlar h ak knda daha nceden bild iklerim izi deitirm eye devam ediyor. Burada bir konuyu da vurgulamak gerekli. nsanlarn ortaya knn son 5-6 milyon yllk bir srece dayand ve bu canlln tarihine gre olduka ksa saylabilecek srede dnyay ne kadar yaanlm az bir hale getirdiimiz gz nne alnrsa, dinozorlarn 160 m ilyon yl boyunca soylarn srdrmede ne kadar baarl olduklarn gre biliriz.

Dinozorlarn boyutlar
D inozorlarn boyutlar bir tavuk boyutundan balina boyutuna kadar eit eittir. D inozor kelim esi sylen diinde, o k kiinin akim a devasa yapsyla tarihncesi aalarn tepelerinden beslenen A patosaurus, korkutucu yapsyla T yrannosaurus ya da tank gibi yapsyla T riceratops gelecektir. Bununla birlikte birok dinozor o k daha kktr. rnein, C om psognathus burnundan kuyruk ucuna kadar yaklak 70 cm boyunda olan bir etildir. Na sl m em elilerde boyut eitlilii ok fazla ise, dinozorlarda da ok farkl boyutlar gzlem lenir. D inozorlarn nasl bu derece byk boyutlara ulaa bildikleri m erak edilen bir konudur. Byk olaslkla bu lunduklar devrin zellikleri ve ortam daki dier trlerin rekabet eksiklii sayesinde ar boyutlara ulamlardr. Tabi byk boyutlar trlere farkl avantajlar da salam tr. rnein, sauropod devasa boyutlardaki vcut yaps sayesinde, avclara kar pasif bir korum a salam tr. Na sl yksek hz, sivri di ya da dayankl zrh tr iin avan tajl olabiliyorsa, dev boyutlar da avantaj yaratabilir.

6.4. DNOZORLAR DEVR

A ^ I Dinozor nedir? Lm I Temel zellikleri nelerdir?


Bu ksm da dnya zerinde 1 60 m ilyon yldan uzun b ir sre baskn olarak bulunan dinozorlardan bahsed e ceiz. Bilim sel konularla o k ilgili olm ayan k iiler iin b ile, d inozorlar heyecan ve aknlkla takip edilen bir konu d ur. evrenizdeki herkesin dinozorlar hakknda b ir fik ri olduunu g rebilirsiniz. Genel kabul gren fi k irlere gre, dinozorlar devasa boyutlarda, soukkanl, yava hareket eden, aptal, acm asz srngenlerdir ve bir g ktann D nyaya arpm asyla ortadan kalkm lardr.

182

50 SORUDA YAAMIN TARH

YK R /D N O ZO R IA R DEVR

183

Dinozorlar soukkanl myd?


Genel dncenin tersine, birok dinozorun, memeliler ya da kular gibi scakkanl olmas yksek ihtimaldir. Bizi bu sonuca gtren farkl bulgular bulunuyor. rnein, ke m iklerin byme hznn yksek oluu scakkanll gs teren bir kant olabilir. ok souk blgelerde bulunan di nozor fosilleri de scakkanll gsteren bir kant olabilir. Ylan ya da srngenler gibi soukkanl hayvanlar, havann ok souk olduu blgelerde yaamlarn kolaylkla srd remezler. Bu yzden souk blgelerde yaam dinozorlar, scakkanlla bir iarettir. D inozorlarn hzl hareket ediyor olmalar da, scakkanl olduklarn gsteren bir iarettir.

Dinozorlarn hzlar
Baz dinozorlar m odern m em eliler kadar hzl hareket ediyordu. Bu ekilde olduunu dnm em iz iin birok neden var. F osil yataklarnda bulunan geni aralkl izler, buna bir rnektir. zleri brakan dinozorun boyutu ve ya ps bilindiinde, dinozorun sa ve sol ayaklar arasndaki m esafeden yola klarak hz hesaplanabilir. rnein, bir insan yrrken 0 ,6 -1 ,0 m mesafe yol alrken, kou annda 1 ,2 -1 ,5 m yol alacaktr. Teksasta bulunan ve A crocan thosauru s olduu d nlen avc dinozorun brakt ayak izlerinden 4 0 km/saat hzla kotuu hesaplanm tr. Benzer ekilde A llosaurus ve T yran n osauru sun insandan daha hzl koabildikleri dnlm ektedir. Zrhl dinozorlarla devasa sauropodlar byk ihtim alle daha yava hareket ediyordu. Genel olarak ise, daha kklerin daha aktif ve hzl olduklar sylenebilir.

ekil 1 1 8 . G enel snflandrm ada dinozorlar, tim sahlar ile birlikte Arkozorlar iinde yer alr. ekilde, gruplardaki tm trler gsterilmiyor. Sada Pterosaurlar, gklerin hkim leri.

Dinozorlarn kefi
B ilinen en eski belgelenm i dinozor k eiflerinden b i risi 1 6 7 7 de In g iltere-O xfo rd da yaplan fosil keifleridir. Bulunan fosil bir M eg alosaru s uylukkem igidir. Doa b ilim ci R obert Plot fosili, bir insann ya da dier bir hay vann uylukkem ii olarak tanm lam tr. Yine IngiltereO xford sh ireda, 1 8 1 8 de, zerinde dilerle b irlik te bir ene kem ii kefedilm itir. Fosilin geldii canl M eg a losaurus olarak isim lend irilm itir. Ig u an od on ise ilk olarak 1 8 2 5 ylnda tanm land. 1 8 4 2 ye gelinceye kadar devasa ve garip b iro k fosil k aln ts kefedilm iti. Sr R ichard Owen kefedilen bu kaln tlarn im diye kadar b ilin m eyen bir hayvana ait olduunu ileri srd ve hayvana Y u nancada k orku n s rn gen anlam na gelen d in o z o r ism in i verdi. Bu dnem den kalan izim ler, d inozor larn ar boyutlardaki srngenler olarak d nld n gsteriyor. A slnda, yzeysel ben zerlikler olsa da dinozorlar srngen deildir. A rclosa u ria ad verilen bir gruba dahildirler. Bu grupta dinozorlarla birlikte kular ve tim sahlar da bulunur.

Dinozorlar aptal myd?


Baz dinozorlarn beyin-vcut orannn m odem trlere yakn olduunu biliyoruz. Son bulgular baz dinozorlarn srler halinde yaadn gsteriyor. Birou yavrulary la ilgilenm itir. Gnm zde benzer davranlar ku sr lerinde, bizon srlerinde, kurtlarda, aslan srlerinde ve balklarda da grlm ektedir.

184

50 SORUDA YAAMIN TARH

Y K R /D N O ZO R IA R DEVR

185

Dinozorlarn snflandnlmas
Dinozorlarn (kular dahil), Pterosaurlarn ve m o dern tim sahlarn or
ekil 1 1 9 . Solda, Saurischia takm nn leen kem ii; sada, O rnithischia takm nn leen kemii.

tak atas 2 5 0 m ilyon yl nce yaam Ar-

kozorlardr. Arkozor olup da dinozorlar arasnda snflandrlm ayan Pterosaurlar, dev kanatlaryla birok filme de konu olm u, M esozoyik D nem gklerinin hkim leridir. (ekil 118) D inozorlarn snflandrlm asnda farkl sistem ler k u l lanlsa da, yaygn olarak kabul gren sistem e gre iki dinozor takm bulunur: Saurischia ve O rnithischia. Bu ayrm n tem elinde leen kem iklerin deki ekil farkll bulunur. Saurischia takm nda kask kem ii k n ts ile ri doruyken, kala kem iind eki oturga kem ii ise geri dorudur. O rnith ischia alt takm nda ise her iki kem ik de geriye dorudur. Bu basit b ir snflandrm a yolu o l m asna karn 19. yzyldan beri kullanlm aya devam etm ektedir. (ekil 119) Tannm etil dinozorlar Sau rischia takm m dandr; b ilin en en byk otobu r dinozor da bu takm dandr. (ek il 120) Bu takm kendi iin d e Theropoda ve Sauropodom orpha olm ak zere iki alt takm a ayrlr. O rn it h isch ia takm ndakilerin tm ise otuldur. Alt takm lar
ekil 1 2 0 . Saurischia takm ndan Tyrannosaurus rex (solda) yaam en byk etil dinozorlardand. Bilim insanlar T. rex' in bir srta 2 0 0 kilodan fazla eti yutabildiim dnyor. Velaciraptor mongoliensis (sada) ise, ku benzeri tylere sahip olsa da uamyordu.

ekil 1 2 1 . O rnithischia takm ndan Ankylosaurus magniventris (solda) avclardan korunm ak iin kemiksi srt tabakas ve ineler gelitirmi. Triceratops'un (sada) ba, en heybetli zelliiydi. 1 ,2 -1 ,5 m byklndeydi ve etkileyici boynuzlar ve arkada kafa tabakas vard.

ise O rnithopoda, M arginocephalia ve T hyreophoradr. (ek il 121) Paleontologlar dinozorlarn snflandrlm asnn de taylar h akkn d a farkl grlere sahipler. Bunun tem el nedenlerinden biri, b iro k fosilin eksik olm as ve elde edilen fosil ksm larn n da farkl farkl yorum lanabilm esidir.

Kular dinozorlarn gnmzdeki temsilcisidir


D inozorlarn Saurischia takm m , kularn son ortak atas olarak da tanm layabiliriz. M odern kular d in ozor larn b ir alt takm nn devam eklinde gnm ze kadar gelm itir. G nm zde devasa boyutlarda vahi d in o zorlar bulunm asa da, kular dinozorlarn gnm zdeki tem silcilerid ir. (ek il 122)

ekil 1 2 2 . Tim sahlar ve dinozorlarn ortak atas Arkozorlardr. Kular da Troodon gibi etil, iki bacak zerinde hareket eden dinozorlarn evrilmesi sonucu ortaya kmtr. Sada Archaeopteryx lithographica, dinozor penelerine ve tyl ku kanatlarna sahiptir. M odern kulara gei formudur.

186

50 SORUDA YAAMIN TARH

YKR/DNO ZORLAR DEVR

187

A O H rO

Dinozorlarn yaad dnemin zellikleri nelerdir?

yonlarca yllk bir sre sonunda ktalar birbirlerinden b in lerce km uzaklaabiliyordu. Triyas Devri baladnda dnya zerinde Pangea ad verilen tek bir sperkta bulunuyordu. Pangea, Ju ra Dev ri boyunca ikiye blnerek, gneyde Gondvana, kuzeyde ise Laurasia ktalarn oluturm utur. Kretase D nem i b o yunca da, gnm zn m odern ktalar olumaya bala m tr. Gondvana blnerek A ntarktika, Gney Amerika, Avustralya ve Afrika Ktalarn olutururken, Laurasia ise Kuzey Amerika, Avrupa ve Asya Ktalarn oluturm utur. Zaman ierisinde de bu ktalar gnm zdeki yerlerine doru kaym tr. G enel olarak bakldnda, M esozoyik D nem deki ik lim, gnm zdekinden daha scakt ve klar ile yazlar arasnda fazla bir fark yoktu. D inozorlarn tropik blge lerde m i yoksa l alanlarnda m yaadklarn tam olarak sylem ek m m kn olmasa da, bu dnemde farkl lm an blgeler ve orm anlarn bulunduu biliniyor. Toprak y zeyinde ayrlarn olmad, bunun yerine kk ereltiotlarnm bulunduu dnlyor. Triyas Devri balarnda (2 5 1 -1 9 9 m y) dnya zerin deki ortalama scakln 10-15 C olduu, ancak dnem in sonlarna doru iklim in daha kuru ve scak olmaya bala d ve Pangeanm zerinde yer yer llerin ortaya kt dnlyor. Kuzey Yarkrede gingko ve aas ereltiotu orm anlar gelimeye balarken, ekvator yaknlarn da kozalakl aalar ve tahllar geliti. Su kaynaklarnn evrelerinde ise atkuyruklar yetiiyordu. Devrin sonunda Pangea blnm eye balad. ncelikle Avrupa Afrikadan ayrld ve arada Tetis ad verilen bir okyanus olutu. D e vamnda da Gney ve Kuzey Am erika m erkezden uzak latlar. Aralarda oluan yeni okyanuslar ise canl trle rinin birbirine karm asn engelleyen yeni doal snrlar oluturdu. Ju ra Devri boyunca (1 9 9 -1 4 5 m y), yamurlarn artma syla okyanuslar ykseldi. Gnmzdeki tropik ormanlar da grld gibi gr otlaklar ve ayrlar, dnya yzeyi nin ounu kaplad. Daha nceden llerle kapl blgeler

geni apl kitlesel yok olu gereklemiti. De niz trlerinin yzde 9 5 e, kara trlerinin de yzde 70e yakn ortadan kalkmt. Bu yok oluun nedeni yksek ihtimalle iklim deki ar dalga lanmalard. Kresel buzlanma ve snma dngleri sonu cunda, trlerin ounluu uyum salayamayarak ortadan kalkt. Sonu olarak yeni dnemde gelecek olan yeni trler iin yer alm oldu. (ekil 123)
tehlikesinden uzak hzl bir ekilde gelitiler ve eitlendiler.

Permiyen Dnemi sonunda meydana gelen yok olu sonrasnda, yeni gelen trler, rekabet ve avc

ekil 123.

Permiyen D nem inin (2 9 0 -2 4 8 my) sonun da, dnyada yaanan en

Bundan sonra gelen dnem , dinozorlarn dnya ze rine yayld ve hkim olduu M esozoyik D nem dir (2 5 1 ,4 m y-65,5 m y). devre ayrlr: Triyas (Triyasik) Devri (2 5 1 -1 9 9 m y ),Ju ra (Jurasik) Devri (1 9 9 -1 4 5 my) ve Kretase Devri (1 4 5 -6 5 m y). M adagaskarda bulunan 2 40 m ilyon yllk kanguru boyutundaki otul Prosauropod fosilleri, bilinen en eski dinozor fosillerindendir. Daha iyi bilinen ve dinozorla rn ortaya kn simgeleyen fosiller ise yakn dnemde A rjantindeki shigualasto ukurunda bulunan ve 228 m ilyon yl nceye tarihlenen fosillerdir. Bu fosiller nede niyle baz bilim insanlar Gney Am erikay dinozorlarn beii olarak adlandrmaktadr. D inozorlar, dnya zerin de geirdikleri 160 milyon yl sonunda, gnm zden 66 my ortadan kalkm lardr. Dnya yzeyi M esozoyik Dnem boyunca gnm z den ok farkl bir ekildeydi. Yzey yava da olsa srekli bir deiim halindeydi. Ktalar birbirlerinden ayrlyordu. Ayrlm a yl ierisinde o k fazla olmasa da (7 -8 cm ), m il

188

50 SORUDA YAAMIN TARH YKR/DNOZORLAR DEVR

189

verimli ayrlarla rtld. Bu dnemden kalan geni kmr madenleri geni b it kisel yaamn kantlardr. Tahllar, ereltiotlar, aas ereltiotlar, kozalakl aa lar ve dev likenli yosunlar ormanlar ve bataklklar kaplad. Bu devirde birok yeni dinozor tr ortaya kt. Bunlar arasnda Stegosaurlar, Brachiosaurlar ve Allosaurlar bulunur. (ekil
ekil 1 2 5 . A llosaur Ge Jurasik D evir'dekl en nem li avcyd. Hem hzlyd, hem de avlarn pusuya drerek avlard.

nozorlarm dnya ze rinde yaadklar 160 m ilyon yllk bir zam a na gre 100 binyllk bir zaman dilim i, anlk bir yok olu olarak de erlendirilebilir. Nede ni ne olursa olsun, K-T yok oluu, dinozorlar la birlikte birok kara ve deniz trnn de

ekil 1 2 4 . Jurasik Dnem boyunca iklim scak ve nemliydi. Bitkiler ve hayvanlar rahata gelitiler. Birok yeni dinozor tr ortaya kt. Bunlar arasnda Stegosaurlar, Brachiosaurlar ve A llosaurlar bulunur.

sonunu getirm itir. Ancak, ilgin biim de, timsah ya da kaplumbaa gibi srngenler bu dnem de yok olmadan yollarna devam etmitir.

124, 125) Kretase Devrinde (1 4 5 -6 5 my) Ju rasik Devrinde orta ya kan dev ormanlar ortadan kalkmaya balad. Dnemin ortalarna doru kresel soumann gereklemeye bala masyla daha farkl bitki trleri geliti. Kayn, incir, m anol ya gibi iekli bitkiler ortaya kt ve tohumlu ereltiotlar ortadan kalkt. Kretase Dnem sonlarna doru dinozorlar gnmzdekine benzer ormanlarda yaamaya balamt.

Dinozorlarn yok oluuyla ilgili farkl teoriler


Peki dinozorlara ne oldu? Cevab kesin olarak bilm iyo ruz. ok farkl teoriler, dinozorlarn nasl yok olduunu aklam aya alt. Her bir teorinin gl yanlar olduu gibi, zayf yanlar da var. Hatta dinozorlarn tamamen yok olm ad ve T yrannosaurus gibi avc dinozorlarn m odern kulara evrildii, olduka kuvvetli bir teoridir. G nm zn kular halen yaam n srdren dinozorlardr. T eorilerin tem elini oluturan n ed enler arasnda, ik lim lerin deim esi, sera etkisi, dinozorlarn a n bo yu t lara ulam as, h astalk ve salgnlar, alk, yum urtalarn avlanm as, yaam a ans dk yum urtalar, m em elilerle ek o lo jik olarak yer deitirm eleri, D nyann m anyetik alanndaki deim eler, uzayda yakn bir blgede m ey dana gelen b ir spernova patlam as gibi ned enler b u lu nuyor.

A A I Dinozorlar 1 w I nasl yok oldular? (oldular m?)


D inozorlarn yok olmasyla ilgili farkl teoriler olsa da hepsinin ortak noktas, dinozorlarn 160 m ilyon yl b o yunca dnya zerinde yer aldktan sonra, gnmzden 6 6 m ilyon yl nce birdenbire ortadan yok olduudur. Yok oluun gerekletii je o lo jik dneme K -T snr (K re tase- Tersiyer snr) ad verilir. D inozorlarn baskn oldu u Kretase D nem inden m em elilerin baskn hale getii Tersiyer D nem ine geii iaret eder. D inozorlarn birdenbire ortadan kaybolduklarm sy lesek de, bu sre yz binlerce yla yaylm olabilir. Di-

Meteor arpmas
Gnm zde geni olarak kabul gren teori, Dnyaya arpan bir m eteorun dinozorlarn sonunu getirdii ynn dedir. M eteorun dm esi nedeniyle havalanan toz bulutu atm osferi sarm ve gne nlarnn yzeye ulam asn engelleyerek m evsim lerin deim esine neden olmutur.

190

50 SORUDA YAAMIN TARH

YKR/MEMELLERN GELM

191

Bu nkleer k olarak adlandrlr. G ne ndan yok sun kalan baz bitkiler ve bitkilerle beslenen otul hay vanlar ve son olarak da otul hayvanlarla beslenen etil hayvanlar yaam larn devam ettirem em itir. E kolojid eki bu deiiklik, je o lo jik zaman leklerine gre hzl bir ekilde meydana gelmi ve canllarn bu hzl deiime uyum salayabilmesi ve evrilmesi iin yeterli zam anlan olm am tr. Ortama uyum salayamayan bir canl grubu da dinozorlardr. M eteor byk olaslkla 10-19 km apuldayd ve M eksikada bulunan Yukatan Yarm adas kylarnda 120 km apnda bir krater (C hicxu lu b K rateri) oluturm utu. arpm ann iddetiyle ilk olarak erim i kaya ve toz b u lu tu dnya apnda yaylm , buhar haline gelm i m ineral ler atm osferin st tabakalarna salm ve yllar boyunca da gne n engellem iti. (ekil 126) A ncak yaplan baz alm alar, sz edilen m eteor arp m asnn yok olutan 3 0 0 .0 0 0 yl kadar nce meydana gel diini ne sryor. Bu yzden dinozorlarn yok oluu iin m eteor arpm as dnda bir neden aramak daha m antkl grnyor.

Sandiadaki bilim insanlarnn yaptklar sim lasyon, 9 ,7 km apnda bir asteroidin 7 2 .0 0 0 km/saat hzla Dnyaya arptnda 2 4,1 km derinliinde bir krater oluturaca n gsteriyor. Dnya ierisinde yaylan ok dalgalar 80 dakika ierisinde Dnyanm dier tarafna ularken, bir yandan dierine doru bir boru hatt gibi yok ederek iler leyecektir. Teoriye gre u anda H indistann bulundu u yerde meydana gelen dev volkanik patlama D eccan T raps ad verilen lav akntlarn oluturm utur. D eccan Traps ile C hicxulub Krateri tam olarak Dnyanm zt ta raflarnda olm asalar da, D eccan Trapsn kar tarafnda Pasifik O kyanusunun dousunda deniz dibinde bulunan izler bir arpm ann kantlar olabilir. Baz bilim insanla rnn ne srd gibi birden fazla m eteor arpm as ayn zamanda da meydana gelm i olabilir. A ncak hl kurbaalarn, tim sahlarn, kaplum baala rn, deniz trlerinin ya da m em elilerin yaam larn nasl srdrdklerini bilem iyoruz.

6.5. MEMELLERN GELM z

ifte felaket: Meteor arpmas ve volkanik patlamalar


M eksikadaki Sandia Ulusal Laboratuvarlarndan bir grubun ne srd yeni bir teoriye gre, dinozorlarn yok oluunun iki farkl nedeni vard. Dnya yzeyine arpan
Bykbir meteorun Dnya ya arpmas dinozorlarn sonunu getirmi olabilir.

A |T I Memeliler T 13 I nasl ortaya kt?


Bizim de iinde bulunduum uz m em eliler sn fn n dnya zerinde ortaya kn ve yaylm alarn daha iyi kavrayabilm ek iin, zamanda biraz daha geriye gitm ek gerekiyor. Yaam n karalarda olm ad, sadece okyanus larda bulunduu zamandan balayabiliriz.

ekil 126.

meteor Dnyanm dier tarafnda devasa volkanik patlamalara, neden olmu olabilirdi. arpma nedeniyle oluan kaya ve toz bulutu, volkanik pat-

'}' J '

>

lamayla yaylan kllerle / ^ \ .t birleerek dnya apnda -> M i r bir kaosa neden olmu ve birok bitki ve hayvann

nce balklar ve sudan karaya k


Gnm zden 5 1 0 m ilyon yl nce balklar denizler de ortaya kt. O dnem de yaam sadece suda b u lu nu yordu. 3 5 0 my de n celikle baz b cek ve bitkiler karada

jyfe

sonunu getirmitir.

192

50 SORUDA YAAMIN TARH

YKR/MEMELLERN GELM

193

lar ve sonraki birka m ilyon yl sonra da ilk m em eliler var d. (ekil 128)

lk basit memeliler
lk m em elinin hangi canl olduu bilinm ese de, Morganucodon cinsi ve zellikle M organucodon w atsoni tr ilk memeli trlerinden biridir. 10 cm uzunluunda, sansara benzer hayvann ilk fosilleri Galler ve Ingilterede ve son ra da in, Hindistan, Kuzey Amerika, Gney Afrika ve Bat Avrupada bulundu. G

ekil 1 2 7 . M em eli benzeri srngenlerden 2 6 0 my yaayan Anfeosaurus (5-6 m boyunda ve 5 0 0 -6 0 0 kg a rlnda, etil) ve 2 5 0 my yaayan Lystrosaurus (1 m boyunda otul) bu dnem in rnekleri arasnda gsterilebilir.

gelimeye balad ve devam eden 5 0 m ilyon yl boyunca da oalarak sonradan gelecek avc canllar iin zengin bir m en oluturdular. Ksacas, sonradan gelecek daha farkl ve yeni trler iin karalar hazr hale geliyordu. Sonunda baz balklarn yzgeleri bacaklara dnt, zaman ierisinde akcier yaps gelitirdiler ve sudan ka raya gei balam oldu. 41. Soruda, sudan karaya gei ten daha detayl olarak sz etm itik. Devam eden 10 m ilyon yl ierisinde am fibilerden (suda ve karada yaayabilen canllar, iki-yaam llar) ilk srngenler evrilmeye balad. Bu ilk srngenlerden evrim leen gruplar arasnda tim sahlar, dinozorlar, kular ve m em eli-benzeri srngenler vard. ite m em elilerin evrim indeki ilk aama, ilk defa 285 m ilyon yl nce ortaya kan m em eli benzeri srngen lerdir. Hzl bir ekilde evrim letiler ve ok farkl gruplar oluturdular. Srngen olduklar halde mem eli benzeri zelliklere sahiptiler. (ekil 127) M em elilerin de bu grup lardan bazlarnn devam eklinde ortaya kt dnl mektedir. M em eli benzeri srngenler, Perm iyen D nem in in so nuna, 245 m ilyon yl ncesine kadar olduka baarlyd, ancak tm dnyay etkileyen byk bir felaket sonucu trlerin tamamna yakn ortadan kalkt. Meydana gelen dier byk felaketlerde olduu gibi yeni ve farkl canllar h zlca ortaya kt ve yok olan organizm alarn brakt boluu doldurdular. Yeni gelenler arasnda ilk dinozor

ekil 1 2 8 . M em eli benzeri srngenlerle ilkel m em eliler arasnda benzerlii gsteren bir izim.

nmzden 2 0 0 -2 1 0 my yaa d dnlyor. Bu ilk m e meliler kk, bcekle beslenen, geceleri avlanan, kll ve scakkanl canllard. (ekil 129)

Dinozorlarn glgesinde
Ju ra (Jurasik) Devri boyunca m em eliler kk boyut larda kalm aya devam etti. G eceleri avlandlar. D inozorla rn ayaklar arasnda yaadklar sylenebilir. Byk ih ti m alle oalm ak iin yum urtluyorlard. Ju ra Devri sonlarnda yaam sekiz tem el m em eli kolu biliniyor. Ju ra sik sonlarna doru m ultituberculate ad verilen ufak kem irgen benzeri m em eliler ortaya kt. Bunlar en baarl ilkel m em eli gruplarndan biridir ve gnm zden 30 m ilyon yl ncesine k a dar, yani 130 m ilyon yl boyunca yaam larn sr drm lerdir. Bu grubun
ekil 1 2 9 . M organucodon byk bir fare boyutunda krkl bir hayvand ve m odern memelilere benziyordu.

194

50 SORUDA YAAMIN TARH

YKR/MEMELLERN GELM

195

daha sonra gelen baz tr lerinde kese benzeri yap lar bulunuyordu. Yavrular olgunlam adan dourulup, kese iinde byt lyor olm aldr.
ekil 1 3 0 . Repenomamus'un kk dinozorlarla beslendii dnlyor.

M em eliler, Ju ra Dev ri boyunca genel olarak

dinozorlarn glgesinde kalsalar da, 13 kg arla kadar kan rnekleri olm utur. Kretase D nem inin ilk zamanlarnda (130 my) yaayan etil m em eli R epenom amus robustusun kk dinozorlar avlad bilinm ektedir. (ekil 130)

ekil 1 3 1 . Dev Indricothrium , ift boynuzlu Brontofher/um ve kl dili Smj'/oc/on, dinozorlarn yokluunda rahata gelien ve eitlenen memelilere rneklerdendir. ekiller birbiriyle lekli deildir.

Dinozorlarn sonu ve memelilerin ykselii


Kretase Dnemi sonlarna doru yaam n srdren bildiim iz 15 m em eli grubu bulunuyordu. Ancak bu d nem in sonunda yaanan felaket sonucu trlerin byk ksm ortadan yok oldu. 44. Soruda ayrntl olarak sz ettiim iz gibi, K-T snr (K retase-Tersiyer snr) diye an lan bu olayn nedeni tam olarak bilinm ese de, Dnyaya arpan bir m eteor nedeniyle yaanm olabilecei zerin de durulm aktadr. Bu felaket, dinozor ve uan srngen lerin sonunu getirm itir. Felaketle birlikte ortadan kalkan trlerin boaltt habitatlara yeni gelen trler yerlem i tir. Bu durumdan en iyi yararlanan grup m em eliler o l m utur. Felaket sonras soyunu srdrebilen 10 memeli grubu, devam eden 15 m ilyon yl iinde 78 farkl memeli ailesine dallanm tr. Paleojen D nem i balarnda, farkl cins says 4 0 tan 2 0 0 e kadar km tr. Paleojen Dnemi ortalarna doru ise (45 m y), bugn var olan temel m e m eli gruplarnn tm ortaya km t. rnein, primatlar 65 my ortaya km t. G rlecei gibi dnya zerinde srekli olarak baskn olan b ir tr yok. ok baarl trler bile farkl nedenlerle ortadan kalkm ve yerlerini yeni trlere brakm lardr. Ju ra ve Kretase D evirleri (1 5 0 m ilyon yl) dinozorlarn

baskn olduu dnemdi. Bu dnem lerde m em eliler de ortaya ktklar halde, dinozorlarn hkim iyeti altnda kaldlar ve rahata geliecekleri bir ortam bulamadlar. Ancak Tersiyer D nem i, m em elilerin dnem i oldu. D ino zorlar ortadan ekilm iti ve m em elilere ok farkl ek il lere ve boyutlara varabilecekleri bir ans kaps alm t. O dnem den gnmze kadar geen srede m em eliler baskn sn f olarak devam etse de, getiim iz 10 m ilyon yl ierisinde 2 4 temel m em eli grubundan 6 sm n soyu t kenm itir. Bunun nedenini tam olarak bilm iyoruz. Paleojen D nem sonlar ve N eojen D nem inden (3 0 -5 milyon yl ncesi) kalm a ok m iktarda fosil elde edildi. Bunlar arasnda, omuz ykseklii 5 ,4 m olan dev kara m e melisi Indricothriu m da bulunuyor. ift boynuzlu, bir fil boyutlarndaki B ron totheriu m , dev k l dili kedi Sm ilodon trleri sonradan tkenen m em elilerdendir. Bu trler m em elilerin ulatklar farkl boyut ve ekiller hakknda bize fikir verebilir. (ekil 131)

YK R /N SAN IN EVRM

197

196

50 SORUDA YAAMIN TARH

6.6. NSANIN EVRM

A S I nsan O I nasl evrimleti?


Dnya zerinde ilk canlln gelimeye balam asnn zerinden m ilyarlarca yl getii halde, bizim trmz olan insann tarihi sadece 6 -7 m ilyon yl geriye giden bir sre. Bu sre, Dnyan n ve zerindeki canlln yalar dikkate alndnda o k ksa bir zaman dilimi. Her ne kadar kendim izi dnyann efendisi olarak grme fikri houm uza gitse de, dnya zerinde yaam m ilyon larca farkl trden sadece birisiyiz. Buna karn, dnyay ve zerindeki canllar bu derece kkten etkileyebilen bir baka canl tr daha olm am tr kukusuz. ncelikle u bilinm elidir ki, insan dnya zerinde b ir den ortaya km ad. M ilyonlarca yl sren evrim sel dei im ler sonucunda bugnk halini ald. Zaman ierisinde her kesine yaylarak, dnyann geleceini kkten etki leyen birinci faktr haline geldi. Evrim sel biyologlar insann evrim inin nasl gerekle tiini ortaya koym ak iin saysz aratrm a gerekletirdi. Bu alm a alan srekli olarak gelien ve yeni bulgularla ekillenen bir alan. Yeni kantlar, bulgularla ortaya k on u lan yeni hipotezler test ediliyor, dorulanyor ya da dei tiriliyor; ancak ilerlem e devam ediyor.

nsann dnya zerindeki yolculuu:


nsans trlerden modern insana hangi aamalardan geildi? nsan doann bir parasdr ve daha nce yaam t r lerden evrilerek ortaya km tr, insann akrabas olarak tek b ir trden bahsedemeyiz. H er canl tr ile akrabalk bam z bulunur. nem li olan zamanda ne kadar geriye gittiim izdir. Dier canllar arasnda, insanlar bir gruba

koym ak gerekirse, bu grup prim atlar olacaktr. Bu gru bun yeleri ile akrabalm zn dier canl trleri ile olan akrabalm zdan daha fazla olduu bilim sel olarak tart ma gtrm eyecek ekilde ispatlanm tr. (ekil 132) Prim at takm tem el olarak iki alt gruba ayrlr: nem li burunlu m aym unlar ve kuru burunlu maym unlar, ilkel m aym unlar, eski dnya m aym unlar, yeni dnya may m unlar, gibonlar, orangutanlar, goriller, em panzeler ve insanslar da prim atlar ierisinde yer alr. nsanslar la em panzeler arasndaki ayrm, gnm zden 6 -7 my Afrikada gereklem itir. Ancak ayrm gerekletikten sonra, dorudan bizim trmz olan H om o sapiens'e gelinm em itir. em panzelerle ayrm gerekletikten sonra insanslar, gnmzde yok olm u b iro k yeni tr olutur mu, devam eden zaman ierisinde de gnmz m odern insanlarna gelinm itir.

nsans ailesi
6 m ilyon yl ncesinden gnm ze kadar birok farkl insans tr ortaya kt ve zaman ierisinde de yok oldu. ekil 133de insans trlerin ortaya k zamanlar gr lebilir.

198
ugurt

50 SORUDA YAAMIN TARH

YK R /N SAN IN EVRM

199

1 milyon yl ne! 2 myo 3 m yo 4

.... R
Austtoiopithecus Australopithecus afrkanvs

_ SB S SB

m Homo sapiens

........................ Homo ^ B heideibergensis SB SB rutloffensfs S B Homo |Bj ertttus Homo hohitis

_ m m SB Homo Wmneondenhaiensts Hon, SB fioresiensis ...................

B . |g|

............ p . |||

jj| Paranfhrpiu Pofonthroous robustus Up boisel Porantftropus aelh.op.cus

si:;!. .A ttftroiop/fh pC U i afarensis Austraoprtnecs anamensis

5 my 6 myo 7 myo

Ardipithecus ramidus

m Ormrin tuaenensis Ifi K Ardipnhecus tcociabba

tchotiensis (Serm T

ekil 1 3 3 . nsan ile empanze arasndaki son ortak atadan itibaren ortaya kan insans trler.

Bu trler birbirlerinden temel zellikler bakm ndan ayrlyordu. im di bu trlerden, nerede ve ne zaman yaa dklarndan ksaca sz edelim. 1) Sahelanthropus tchadensis: Bilinen en eski insan tr lerinden biridir. Gnmzden 6-7 my Orta-Bat Afrikada yaamtr. Maymun ve insan benzeri zellikleri birlikte ba rndrd sylenebilir. Kk bir beyin, eimli bir yz, be lirgin ka knts ve uzun bir kafatas yannda, ufak kpekdii, kk bir yz yaps ve maymunlarn aksine srt yerine kafatasnn altndan balayan bir omurilie sahiptir. ki aya zerinde dik olarak yryebildii ihtimali yksektir. 2 ) Orrorin tugenensis: 6 m ilyon yl kadar nce Dou Afrikada yaamtr. Bir em panze byklndedir ve insanda olduu gibi kk dilerle birlikte kaim bir di m inesine sahiptir. Aalara trm anm ann yannda yerde iki bacaklar zerinde yryor olm as yksek ihtim aldir. U ylukkem iinin yap ve balants iki ayak zerinde hare ket eden hayvanlara benzerlik gsterir. 3 ) Ardipithecus kadabba: ik i aya zerinde dik olarak yrm ektedir. M odern em panze ile ayn boya ve beyin h acm ine sahiptir.

4 ) Ardipithecus ratnidus: Yaklak 4 ,4 my Dou Afrikada yaamtr. lk defa 1 9 9 4 de ortaya karlan tre Ardi ism i verilm itir. Aalara trm anm a ve iki ayak zerinde dik yrm e zelliklerini birlikte ierm ektedir. Bilim insanlarna gre Ardi, insan ve Afrika maymunun em panze benzeri olmayan son ortak atasdr. 5) Australopithecus anamensis: 4 ,2 -3 ,9 my Dou Afrikada yaam tr. M aymun ve insan zelliklerinin karm na sahiptir. Bilek eklem leri, incikkem ii yaps dzenli ekilde iki ayak zerinde dik yrdn; uzun kollar ve el bilek kem ikleri de yksek ihtim alle aalara trm anabildiim gsterm ektedir. 6 ) Australopithecus afarensis: En uzun sre var o l mu ve en iyi bilinen ilk insan trlerinden biridir. Trn 3 0 0 den fazla yesinin fosili karlm tr. 3 ,8 5 -2 ,9 5 my Dou Afrikada yaam tr ve 9 0 0 .0 0 0 yldan fazla varln srdrm tr. nl Lucy fosili de bu trn bir rneidir. M aymun ve insan benzeri zellikleri birlikte barndrr. M aym un benzeri yz yapsna ve beyin boluuna (hacim olarak da) ve uzun gl kollara ve kvrm l parmaklara sahiptir. Bunlar aalara trm anm ak iin gerekli zellik lerdendir. Bunun yannda kk kpekdileri bulunur ve dzenli olarak iki ayak zerinde dik olarak yrr. 7) Australopithecus garhi: ok fazla bilgiye sahip o l masak da yaklak 2,5 my Dou Afrika civarnda yaa d bilinm ektedir. Uzun bir uylukkem iine ve kuvvetli kollara sahiptir. 8 ) Paranthropus aethiopicus: 2 ,7 -2 ,3 my Dou Afrika civarnda yaam tr. Hakknda o k fazla bilgiye sahip de iliz. ne kk bir yze, mega bir die, kuvvetli bir ene ye sahip olmasL inem e kaslarnn gelitiini gsteriyor. 9) Australopithecus africanus: Yaklak 3 ,3 -2 ,1 my Gney Afrikada yaam tr. A natom ik olarak A u stralo pithecu s afaren sis ile benzerlik gsterir. M aymun ve in san benzeri zellikleri birlikte tar. A ncak daha geni bir beyin ve daha k k dilere sahiptir. Uzun kolludur ve eim li b ir yz vardr. ki ayak zerinde yryebildii gibi aalara da trm anabilm ektedir.

200

50 SORUDA YAAMIN TARH

YK R /N SAN IN EVRM

201

1 0 ) Hotno rudolfensis: Yaklak 1 ,9 -1 ,8 my Dou Afrikada yaam tr. 775 cm 3 gibi daha ncekilere gre geni bir beyin hacm ine sahiptir. 11 ) Homo habilis: Y aklak 2 ,4 -1 ,4 my Dou ve G ney Afrikada yaamtr. H om o cinsinin ilk rneklerinden biridir. Daha nceki insans trlerine oranla daha geni bir beyin boluuna ve daha kk bir yze ve dilere sahiptir. Beyin hacm i genilem itir. Bunun yannda uzun kol, ne k k ene gibi maymunsu zellikleri de tar. Bu tr, tatan alet yapan ilk tr olarak kabul edildiin den handy m an olarak da adlandrlr. 12 ) Paranthropus robustus: 1 ,8 -1 ,2 m y, Gney Afrikada yaam tr. Byk b ir ene diine sahiptir ve i nem eyi enenin arkas ile yapar. Geni ve tabak eklinde bir yze enenin arkasnda younlam inem eyi sa layan di yapsna ve kaln m ine tabakasna sahiptir. Bu sayede de fibrilli yiyecekleri ezerek paralayabilirler. 13) Paranthropus boisei: 2 ,3 -1 ,2 my Dou Afrika c i varnda yaam tr. Ayrt edici zellii, dier P aranthropus cinsi yelerinde olduu gibi, youn inem eye uygun ge lim i kafatas yapsdr. zellikle gerideki byk diler inem e srasnda gerekli kuvveti uygulayabilir. ok ge ni ve tabak eklinde bir yze sahiptir. Gem i 1 m ilyon yllk srede beyin hacm inde 100 cm 3lk bir art grl m tr. 14 ) Homo heidelbergensis: 7 0 0 .0 0 0 -2 0 0 .0 0 0 yl nce Avrupada, Asyada ( in ), Gney ve Dou Afrikada yaa m tr. Bu ilk insan tr byk bir ka kem ii, byk bir beyin kafesi ve daha nceki insans trlerden daha dz bir yze sahiptir. Souk iklim lerde yaayan ilk insans trdr ve s kaybm azaltm ak iin vcut yaplar ksa ve genitir. Rutin olarak avclk yapan ilk trdr. Atei ve aatan ya plm m zraklar kullanabilir. Ayn ekilde basit de olsa ilk barnak yapan trdr. 1 5 ) Homo erectus: 1,89 m ilyon yl ncesinden 7 0 .0 0 0 yl ncesine kadar Kuzey, Dou ve Gney Afrikada, Bat Asyada ve Dou Asyada yaam tr. lk Afrika H om o erectus fosilleri, m odern insan vcut

yapsna benzeyen en eski trdr. G rece uzun bacaklar ve gvdeye oranla ksa kollar aalar yerine yerde sren bir yaam iin gelien adaptasyonlardr. Zam ann ounu yerde geiren, uzun m esafeler yryen ve koabilen bir trd. nceki trlerdekine gre, yz boyutuna gre daha byk bir beyin ksesi bulunuyordu. Bu trden bilinen en korunm u rnek Turkana ocuu olarak adlandr lan ve gnm zden 1,6 my yaam bir rnektir. Diler zerine yaplan aratrm alar bu trn bym e hznn b yk m aym unlardakine benzer olduunu gsteriyor. Fosil bulgular, bu trn yal ve zayf bireylerinin bakm yla ilgilendiini gsteriyor. H om o erectu s trnn ortaya k t zam anlar, ayn zamanda tatan alet tekn olojisin in ilk byk bulularndan olan el baltalarnn da ortaya kt dnem lerdir. H om o erectus Afrikaya ve Asyaya yaylm tr. ilk insan trlerinden dnya zerinde varln en uzun zam an srdren trdr. 16) Homo neanderthalensis: Gnm zden 2 0 0 .0 0 0 2 8 .0 0 0 yl ncesinde Avrupada Gneybat Asyadan Orta Asyaya kadar olan blgede yaam tr. Soyu tkenm i insan trleri arasnda bize en yakn akraba olanlar N eanderialerdir. Bize gre daha ksa ve tknaz bir vcut yap sna sahiptir. Bu ekilde daha souk iklim lerde yaamaya uyum salam tr. Beyin hacim leri bizim ki kadar vardr, ancak beynin vcuda oran bizden daha fazladr. Karma ekil 1 3 4 . empanze ile ayrm dan sonra, modern insana kadar ortaya kan insans trler.

202

50 SORUDA YAAMIN TARH

YK R /N SAN IN EVRM

203

k aletler kullanm , atei kontrol etm i, barnaklarda yaam, giysi yapm ve giymilerdir. Byk hayvanlar ustalkla avlyor, ayn zamanda bitki de yiyorlard. Sem bolik nesneler de yapyorlard. llerini gm dklerine ve mezarlara sunduklar iek gibi nesnelerle llerini an dklarna dair bulgular vardr. Dier h ibir prim at ya da ilk insan tr bu derece kom plike ve sem bolik bir hayat tarzna sahip deildi. Bir dzineden fazla N ean dertal fosilinden elde edilen DNA rnei sayesinde, Neandertal Genom Projesi yr tlm ve DNA yaplar ortaya konm utur. 17) H o m o flo r e s ie n s is : Gnmzden 9 5 .0 0 0 -1 7 .0 0 0 yl ncesinde Asyada (Endonezyada) yaamtr. En son kefedilen insan tr olan H om o flo resien sis 9 0 -1 8 0 cm boyunda, kk beyinli, boyutlarna gre byk dilere sahip, ksa bacaklarna oranla byk ayaklara sahip bir trdr. Ta aletler yapm ve kullanm tr. K k filleri ve byk kem irgenleri avlam, yksek ihtim alle ate de kullanm tr. 18) H o m o s a p ie n s : Bizim trmz olan H om o sapiens gnmzden 2 0 0 .0 0 0 yl kadar nce Afrikada evrimlem i ve dnyann her yanm a yaylm tr. (ekil 134)

eski kantlar bu dnemden geliyor. lk insan trlerinden Sahelanthropus ve Orrorin tugenensis, ksa bacaklar zerin de dik olarak yrmeye balad. D ik bir ekilde yrm ek bu trlerin farkl habitatlarda (orm anlar ve ayrlarda) ya amn srdrebilmesine olanak salamtr. ilk insan trlerinin vcut yaplar daha kkt ve ge nellikle de uzun kollara ve ksa bacaklara sahiptiler. B it kiye dayanan besin diyetleri geni bir sindirim sistem i ge rektiriyordu. Geni bir kaburga kafesi ierisinde bulunan mide, barsaklar ve dier organlar besini paralamaya yarar. 6-3 my: lk insan trleri kk vcut yapsna ve b yk bir sindirim sistem ine sahipti. 6-2 my: Bu dnem boyunca ilk insanlar dik olarak y rmeye ve basit el aletleri yapmaya balad. Beyin hacm in de yava da olsa art gzlem lendi. 4 my: Bu dnem deki ilk insan trleri ( A u stralop ith e cus an am en sis ) ounlukla sk aalk ya da ak alanlarda yaad. Bulunan rneklerin vcut yaplar, trn zam an n n ounu iki aya zerinde geirdiini, ancak aalara da trm anabildiim gsteriyor. 3 ,5 -3 my: Farkl A ustralopithecus trleri Afrikann gneylerinden Dou ve Kuzey Afrikaya doru yaylmaya balad. 2 ,6 my: T e k n o lo jin in douu. Yaplan ilk aletler e killendirilm i basit ta paralaryd. eki talan kulla nlarak ta paralar k es ekil 1 3 5 . Basit el aletleri yontulabilir kinletirildi. ilk insanlar talar ve kem ikler kullanlarak devam eden 2 m ilyon yl yaplm aya baland. boyunca yaptklar basit aletleri birer bak, eki ya da tokm ak gibi kullan d. (ekil 135) Byk hay vanlarn etlerini bu aletler yardmyla ufak paralara ayrarak yenebilir duruma getiriyorlard. 2 ,6 -1 ,8 m y: Sosyal ya-

A ^ T 1/

I nsann evrimindeki temel aamalar I nelerdir? nsan dnyaya nasl yayld?

imdi, insann 6-7 milyon yllk hikyesinin ana ksm lar zerinde duracaz. Yeterli zaman verildiinde fiziksel ve davransal olarak nasl evrildiimizi, dnyaya yayld m z, teknolojiyi gelitirerek dier trlere nasl hkimiyet kurduumuzu bu ksmda daha iyi anlayabiliriz. 7-6 my: Son ortak atadan empanze ve insann ayrl mas. Fosil ve genetik kantlar, insan ile em panzenin son ortak atasnn gnmzden 6 -7 my yaadn gsteriyor. 6 my: ki bacak zerinde yrndn gsteren en

204

50 SORUDA YAAMIN TARH YK R /N SAN IN EVRM

205

artm gelimeye balamas. Baz ilk insan gruplar farkl yerlerden basit ara-gereler ve besini toplamaya ve sk lkla tercih ettikleri uyuma ve yem ek yem e noktalarna getirmeye balad. Hayati nem tayan kaynaklarn dier grup yeleri ile paylalmas, bireyler arasnda daha gl sosyal balarn olum asn ve sonu olarak da grubun de vam lln srdrm esini salad. 2 m ily o n -8 0 0 .0 0 0 yl nce: Bu dnemde ilk insanlar dnyann ok farkl yerlerine yayld. Bunun sonucunda da vcut boyutlarndaki artla beraber beyin h acim lerin de de art gerekleti. 1,9 m y: Tm yle ik i ayak zerinde. H om o erectu s un leenkem ii ve uylukkem ii m odern insam nkine benze m ektedir. Bu da bu trn uzun m esafeleri yryebildiini gsterir. Bu dnem de bu zellik olduka avantajlyd. Dou Afrikann evresel zellikleri olduka deikendi. N em li ya da kuru zam anlar arasnda dalgalanmalar ok yaanyordu ve ak allklar yaylmaya balam t. Scak blgelere uyum salayan ilk insan trleri daha dar vcut yaps gelitirdi. Bu yolla vcudun daha serin kalm as saland. Uzun bacaklarn gelim esi daha uzun mesafelere gidilebilm esini kolaylatrd. E t gibi daha hz l sindirilebilen besinlerin yenilm esiyle sindirim sistem i klm eye balad. Bu yolla da daha uzun vcut ve geni beyin iin gerekli enerji de salanm oluyordu. 1 ,8 -1 ,5 my: lk insanlar kem ie ekil vererek basit aletler yapmaya balad. rnein protein bakm ndan zengin olan term itlerin yuvalarn kazm ak iin sivriltilm i kem ikler kullanlyordu. 1 ,7 8 my: lk insanlar Afrikann dndaki blgelere de yaylmaya balad. 1,7 my Dou Asyaya, 1 ,66 my de Kuzeydou ve Gneydou Asyaya ulatlar. 1 ,6 my: El baltalar. Byk talara ekil verilerek ilk baltalar yaplmaya baland. ok am al kullanlabilen ta baltalar devam eden 1,5 m ilyon yl boyunca dnyann ok yerinde kullanld.(ekil 136) 1 ,3 my: H om o cinsi Avrupaya yaylmaya balad. 8 0 0 .0 0 0 yl n ce: A te. Atein kontrol edilmeye ba

lanm as ile insanlar iin b iro k yarar elde edildi. Besinler piirilm eye ba land. Ate evresinde oluturulan kamp blge lerinde bir araya gelen b i reyler arasnda sosyalle m e hzland. Daha rahat ve scak bir ortam la birlikte avc hayvanlara kar g venli bir ortam da olutu rulm u oldu. 8 0 0 .0 0 0 -2 0 0 .0 0 0 y l nce: Beyin hacm inde
8 0 3 .0 0 0 yllk el baltas. h lZ 1 a r tl' ln S a n b e y n

hacm inin en hzl art, iklim in sra d deitii zamanlarda gereklem itir. Daha geni ve karm ak beyin yaps, bu zaman boyun ca, ilk insanlarn birbirleriyle daha yeni ve farkl yollar la etkileim e girm esini salam tr. evre artlar tahmin edilem ez olduu srece, geni beyin yaps ilk insanlarn yaam larn srdrm esini salam tr. 5 0 0 .0 0 0 y l nce: K em ikten yaplm m zraklar ku lla nlarak byk hayvanlar avlanmaya baland. 5 0 0 .0 0 0 -1 6 0 .0 0 0 y l n ce: ilk insanlar daha geni b e yinler gelitirm iti bile. Yeni doan bebeklerin beyinleri daha kkt ve bylece doum kanalndan daha kolay geiyorlard. U zun o cu k lu k dnem inde beyin bym e ye devam ediyordu. E rgenlik dnem inde de genler ye tikinlikle beraber gelecek zorluklara hazrlanm aya de vam etti. 4 0 0 .0 0 0 yl nce: Aatan yaplm m zraklar ile tehli keli hayvanlara gvenli bir mesafede durarak yaklalabiliyordu. Souk iklim lere yaylan trlerin vcut yaps da ksald ve geniledi. Bu yolla da vcuttaki s korunm u oldu. ilk barn aklar: Bu dnemde ilk barnaklar oluturul maya baland. nsanlarn atein evresinde bir araya gel

206

50 SORUDA YAAMIN TARH

YKR/N SAN IN EVRM

207

dikleri blgelerde yaptklar baz ba rnaklarn boyu 15 m etreye kadar ulat. (ekil 137) 2 5 0 .0 0 0 Sem boller yoluyla haberlem eye baladllar

ekil 1 3 7 . Tarlhrcesinde barnaklar, insanlar iin korunakl bir ortam salad.

2 0 0 .0 0 0 yl nce: Homo sapiens. M odern insanlar Afrikada, iklim de meydana gelen byk dalgalanmalar zamannda evrimleti. M odern insanlar da ilk insanlar gibi besini toplad ve ayn zamanda avclk da yapt. ev reden gelen glkler karsnda yaam larn srdrm ele rini salayan davranlar gelitirdiler. lk m odern insanlar dnya zerinde en az farkl ilk insan tryle ayn anda yaad. Zaman ierisinde, modern insanlar dnya zerinde yayldka, dier tr ortadan kalkt. nsan aile aacndan geriye bir tek bizim trmz kald. 1 6 0 .0 0 0 -1 3 5 .0 0 0 yl nce: Afrikada yaayan drt fark l avc-toplayc grubu gneye m it Burnuna, Gney Batya Kongo Havzasna ve batda Fildii Sahiline doru ilerledi. 1 2 5 .0 0 0 y l nce: Bir grup kuzeye ynelip Saharay ge erek Nil ve Dou Akdenize ulat. Ancak bu grup 9 0 .0 0 0 yl nce iklim koullar yznden yok oldu. Bu dnemde gerekleen kresel soum a sonucu bu blge ve Kuzey Afrika yaanmayacak bir l haline gelmiti. Bu blgeye daha sonra N ean d ertaller yerleti. 1 0 0 .0 0 0 yl nce: Ku gibi hzl ya da m am ut gibi teh likeli hayvanlan avlamak iin mzraklar gelitirildi. Bu dnem de insanlar len yaknlar iin m ezarlar yapmaya balad. 9 0 .0 0 0 -7 0 .0 0 0 y l nce: engel grevi gren basit alet lerle balk avlamaya baladlar. rnein, tarihncesi kedibal 6 0 -7 0 kg aras geliyordu ve bu baln avlanmas nem li bir besin kaynayd. (ekil 138)

8 5 .0 0 0 y l nce: Bir grup Kzl D enizin azndan (Gates o f Grief) geerek Arap Yarm adasnm kys boyunca ilerleyerek H indistana doru g etti. Afrika dndaki tm insanlar, bu koldan gelen insanlardan trediler. 8 5 .0 0 0 -7 5 .0 0 0 yl nce: Asyann gney kylarndan ilerleyerek Sri bir zamanlar Asyaya bal olan y l Lankadan nce: Bat Endonezyaya getiler. Buradan B orneoya ve Gney ine doru devam ettiler. 7 4 .0 0 0 yl nce: Y ok olm ann k ysn d a! Toba Da volkanik sper patlamas sonucu alt yl sren nkleer k ve devam eden binyl boyunca da buz devri yaand. Bu zaman sonunda insan nfusu 1 0 .0 0 0 e kadar dt. Pat lama nedeniyle Hindistan ve Pakistan 5 m kl altnda kal m t. Devam eden 1 0 .0 0 0 yl boyunca poplasyonda art devam etti. Avustralya ve Yeni G ineye kadar yayldlar. 7 0 .0 0 0 yl nce: H om o erectus tr yok oldu. 6 0 .0 0 0 -4 0 .0 0 0 y l nce: Kal ekil 1 3 8 . O rta A frika'daki c resim ler rettiler. insanlar tarihncesi 5 2 .0 0 0 yl nce: klim in kedibaln yakalam ak iin ucu dikenli m zraklar hzl ekilde snm asyla birlik kulland. te, kuzeyde B ereketli Hilal ve Dou Akdenize doru yerle im balad. 5 2 .0 0 0 -4 5 .0 0 0 yl nce grlen m ini buz anda Trkiyeden Bulgaristana ve ora dan da Avrupaya yaylma devam ettiler. M odern insanlar daha hafif vcut yapsna evrimleti. Ayn dnemde Avustralyaya da ulatlar. 4 5 .0 0 0 -4 0 .0 0 0 yl nce: Dou Asya kysndaki gruplar Kuzey Asya zerinden Orta Asya steple rine doru yayld. Pakistandan Orta Asyaya, Hindi inden T i b et yoluyla Qing Hai Platosuna ulatlar. Boyama ve basit heykel yapm gelimeye balad.

208

50 SORUDA YAAMIN TARH

Y K R /N SAN IN EVRM

209

4 0 .0 0 0 -2 5 .0 0 0 yl nce: Orta Asyal gruplar b at da Dou Asyaya doru, kuzeyde A rktik em bere doru yaylarak Dou Asyadan gelenlerle birlikte Kuzeydou Avrasyaya ulatlar. 3 5 .0 0 0 y l nce: lk basit m zik aletleri gelitirildi. 3 0 .0 0 0 -2 4 .0 0 0 y l nce: Daha sk yaplm giyecekler gelitirildi. 2 8 .0 0 0 y l nce: N ea n d ertallerin (H om o n ean d erth alen sis ) soyu tkendi. 2 5 .0 0 0 -2 2 .0 0 0 y l nce: Yerli A m erikanlarn atalar Bering Boazndan geerek Alaskaya ve Kuzey Am erikaya ulat. 2 6 .0 0 0 -1 7 .0 0 0 y l nce: 2 6 .0 0 0 yl kadar nce, bitki liflerini kullanarak eritler ve sepetler yapmaya balad lar. 1 8 .0 0 0 yl kadar nce de, Japon yada, m lek yapm balad, Kuzey Am erikadaki gruplar Gney Am erikaya kadar yayldlar. 1 7 .0 0 0 yl nce: H om o jlo resien sism soyu tkendi. Bylece dnya zerindeki tek insan tr H om o sapiets kalm oldu. 1 2 .0 0 0 y l nce: Dnm noktas. nsanlar sonunda baz bitki ve hayvanlar bytebileceklerini ve iftletirebileceklerini fark etti. Bunun sonucunda tarm ve hayvanclk gelierek Dnya yzeyinin ekillenm esinde ok nem li bir rol oynad. 1 1 .2 0 0 yl nce rdnde incir yetitirildi. 1 1 .0 0 0 yl nce: rdnde E rika ehri bym eye ba lad. 1 0 .5 0 0 yl nce: Bitki ve hayvan evcilletirilm eye ba land. 10.000 yl nce Afrika ve Ortadouda inek evcille tirilirken, Amerikada kabak retildi. 9 5 0 0 yl nce: O rtado-uda ve Anadoluda buday ekilm eye baland. Trkiyede atalhyk b ir ehir olarak gelimeye balad. 9 0 0 0 yl nce: Koyun Ortadou ve Anadoluda y etiti rilm eye, pirin in de, msr Kuzey Amerikada retilm e ye baland. 8 0 0 0 yl nce: Kelim e ve kavramlar anlatm ak iin sem boller kullanlm aya baland. (ekil 139) G erek an

lamda yaznn kullanm bunu takip eden birka bin yl ierisinde geliti. Tavuk Gneydou Asyada evcil letirildi. 7 0 0 0 y l nce: Patates Gney Am erikada, muz ise ekil 1 3 9 . Asurlulara ait, Gneydou Asyada ekil zerinde sem boller bulunan meye baland. silindir dam ga grlyor. 5600 yl nce: At Avrasyada evcilletirildi. 3 4 0 0 -2 7 0 0 y l nce: 3 5 0 0 yl nce Hattua, 3 4 0 0 yl nce Atina, 3 1 0 0 yl nce ise X ian ( in ), 2 6 0 0 yl nce de Rom a ehir olarak bymeye balad. 2 0 0 0 y l nce: nsan poplasyonu 2 0 0 m ilyona ulat. ay, inde ekilm eye baland. 1 9 5 9 -1 9 9 9 : Sadece 4 0 yl ierisinde insan nfusu iki katm a karak 3 milyardan 6 m ilyara ulat. 1 9 9 5 : Dnya karasal alannn en az yzde 8 3 , insan larn dorudan etkisi altnda. 2 0 1 2 : Tahm in edilen insan nfusu 7 milyar.

I nsann 6 milyon yllk evriminin I kantlar nelerdir?


Aratrm aclar, m ilyonlarca y llk b ir zaman ierisin de, insann hangi yollardan geerek gnm ze ulatn, hangi evrim sel aamalardan getiini, gsterdikleri say sz kantlarla ortaya koyuyor. Bu ksm la ilgili kantlarn bir ksm na evrim in kantlar sorularnda yer verdik. Bu kantlar drt ana balk altnda inceleyebiliriz. D a v ra n sa l k a n tla r P rim at davran: nsanlar prim at ad verilen grubun bir yesidir. Bu grupta bizim le birlikte lem urlar, may m unlar ve goriller gibi sosyal, zeki ve ellerini kullanmada

2 10

50 SORUDA YAAMIN TARH

YK R /N SAN IN EVRM

211

m arifetli trler bulunm ak tadr. Bu trlerde grup ie risinde sesli ve grsel olarak iletiim gldr ve in san larda olduu gibi iki ayak zerinde hareket etm e de grlr. Ayak izi fosilleri: G nmze kadar ulaan ayak izi fosilleri de trlerin dav ranlar hakknda bilgi ve recektir. zi brakan insan trnn boyu, arl, y ekil 1 4 0 . 3,5 milyon yldan daha rme tarz ya da o srada nce, ki nsans D ou A frika'da ka kii olduklar hakknda yeni dm kln zerinde boydan bilgi edinilebilir. zin kald boya dik olarak yrmlerdi. Ayak izlerinin zeri, pa le onto lo gla r blgedeki evresel artlar ve tarafndan kefedildii 19 78 ylna varsa dier hayvanlarn izleri kadar, daha sonra dklen kllerle de yaam tarz zerinde fikir kaplanm t. Bulunduklar yerin ad verecektir. (ekil 140) verilen Laetoli ayak izleri, insanlara d o ru giden soyda an ahta r bir T arihncesi aletler: Tarih kazanm olan dik ekilde yrmenin boyunca insans trlerinin ilk kantdr. ta, kem ik, aa ya da deri den yaptklar basit aletler gn na karldka; o tr lerin nasl yaad, gnlk olarak neler yapt, evresiyle nasl etkileim halinde olduu ve zaman ierisinde nasl evrimletii hakknda bilgi sahibi olabiliriz. Gnm zden m ilyonlarca yl ncesinden kalan binler ce antik rnek, farkl arkeolojik kaz blgelerinde ortaya karld. zellikle ta aletler zam ann etkilerinden daha az etkilendii iin bize nem li bilgiler salyor. Zamann teknolojisi, el becerisi, zihinsel becerinin gelim ilik sevi yesi ya da gerekletirilen yenilikler elde edilen bulgular yoluyla anlalabilir. Milyonlarca ta alet, heykelcik, eki talar, keskinleti rilmi talar, kem ik ya da tatan mzraklar, fildiinden ssler, m lek ve sepetler, ayak izi ya da dier izler, insann zaman ierisindeki evrimsel geliimi hakknda bizi bilgilendirir.

B esin i elde etm ek ve ta m ak: lk insanlar besin lerini avlanarak, leleri ya da yenebilir bitkileri top layarak salarken, zaman ierisinde yerleik dzene geerek kendi besinlerini kendileri retm eye ve ta rmla da uramaya bala dlar. Bitkileri ve hayvanlar evcilletirdiler. G nlk ya am tarzlar nem li lde deimi oldu.
ekil 141 : Bilinen en eski m lek Japonya'da bulunan resimdeki 1 8 .0 0 0 yllk m lek.

B esinlerin tanm as iin deriden antalar yapmaya baladlar ve zam an ierisinde bitki liflerinden rdkleri sepet ve m leklere getiler. (ekil 141) O caklar ve sm aklar: Atein kontrol edilmeye balan masyla birlikte ilk insanlarn yaam tarzlarnda nem li deiiklikler yaand. Ate balarnda bir araya gelerek beslenen gruplar arasndaki sosyalleme, insan evriminde nem li ilerlem elerin yaanmasn salad. Yiyeceklerin pi irilmeye balanmas ve tehlikeli hayvanlara kar gvenli ortam n salanmas, yaamn daha kolaylamasn salad. Bu tr etkinliklerle birlikte insan beyninde de nem li l de hacim art gerekleti. l lerin gm lm esi: lk insanlar zam an ierisinde l lerini de gmm eye balad. M ezar ierisine len kiinin eyalar ya da lm den sonra ie yarayaca dnlen eyalar da konulm aktayd. An ve dier dnya kavramlar gelim eye balad. B ilg ilerin saklan m as: Basit duvar ekillerinden bala narak zaman ierisinde detayl izim lere, m lekler ze rindeki sem bolik haberlem elere gidildi. G iysi yapm : nsann zaman ierisinde evrimine paralel olarak giysilerinde de farkllama gzlemlenmitir. Scak blgelerden souk blgelere doru g edildike daha ka im giysilere geilmi, kem ik ya da fildii ineler yoluyla za-

2 12

50 SORUDA YAAMIN TARH

YK R /N SAN IN EVRM

213

m at iinde gelitirilen rg teknikleri olutu rulmutur. Sanat ve m zik:


ekil 1 4 2 . Resimdeki flt bilinen en eski rneklerden,

4 0 .0 0 0 yl nce en baSt m zik aletleri yap ilm aya balanm tr,


... ( e k l1 ,. 142) , 1 7 -0 0 0

35.000 y! ncesinden

kalm a. Fildiinden yaplm ve en az delikle be notal bir sistemde alnablliyor.

ncesinden itibaren de resim , izim , oym aclk, seram ik ve ablon kullanm ge lim eye balam tr.

hangilerine ise daha uzak akraba olduumuz ortaya k o nuluyor. k i trn DNAlar arasndaki fark, bize o iki trn birbiriyle yakn m uzak m akraba olduu hakknda bilgi verir. nsanlar arasndaki genetik farkllk ortalam a yzde 0,1 civarndadr. nsan ve em panze arasndaki genetik farkllk ise yzde 1,2 civarndadr. Bu oran em panzele rin yakn kuzeni olan bonobolar iin de ayndr. G orillerle aram zdaki genetik farkllk yzde 1,6 iken bu fark oran gutanlarla yzde 3 ,1 dir. nsan, em panze ve bonobolarn goril ve dier primatlara oranla birbirine daha yakn akra ba olduu anlalm tr. DNA karlatrm alarndan insan ve em panzelerin birbirinden 6 -8 my ayrld da ortaya km aktadr. Evrim in kantlarn n ne olduunu ele alan 12. Soru da yer verdiim iz ekil 3 6 da k istik fibroza (kaltsal bir hastalk) neden olan genin insanlarda ve dier hayvan lardaki b en zerliklerin i gsterm itik. nsan geni ve em panze ya da orangutan genleri birb irin e o k ben zerken , akrabalk u zaklatka genler arasndaki b en zerlik de azalyordu. Neandertaller: 1997 ylndan beri, fosillerden elde edi len farkl Neandertal m itokondri ve ekirdek DNAlar aklanyor ve geen zaman iinde de bu DNA dizileri okunuyor. DNA dizilerinden elde edilen bilgiler bize Neandertallerin grnleri, konum a yetenekleri, poplasyon yaps ve m odern insanlarla olan filogenetik ilikisi hakknda nem li sonular verdi. A ratrm aclar N ean d ertal DNA dizisi ile m odern insan ve em panzenin DNA dizilerini karlatrd. ou insan DNA dizisi arasnda ortalam a 8 baz (nkleotid, A TG C ) deiiklii bulunur. Bu farkllk insanla em panze arasn da yaklak 55 iken, N ean d ertal ve insan DNAlar arasn daki fark ortalam a 2 7 ,2 dir. Homo sapiens: Tm dnyaya yaylm tek b ir tr: dnya zerinde yaayan 6 m ilyardan fazla in san n hepsi H om o sa p ien s trne aittir. Her trde olduu gibi bizde de bireyler arasnda eitlilik olduka fazladr. Boyut,

nsan fosilleri
Gnm ze kadar ilk insana ait 6 0 0 0 den fazla fosil lem i para kefedildi. Bulunan iskelet paralar, diler, kafataslar ve dier ksm lar sayesinde bilim insanlar ilk insanlarn boyutlu yapsn ortaya koyabiliyor. Fosiller sayesinde, beyin hacm inde ve vcut boyutlarndaki dei im , hareket organlarnda zaman ierisindeki farkllama, deien di yapsyla birlikte farkllaan besin diyeti ya da yaam n dier ksm lar ortaya karlarak 6 m ilyon yllk insan evrimi aydnlatlyor. Baz trler sadece birka para fosille tem sil edilirken, baz trler iinse binlerce farkl fosillem i para bulunu yor. D ik olarak yrmeye gei, bacaklarn gelim esi ve za m anla aalarda srdrlen yaamdan yere gei, farkl iklim koullarna gre deien vcut yaps, erkek ve dii bireyler arasndaki farkllklar yoluyla sosyal ilikiler, yav rularn byme hz, fosil rneklerinden elde edilen bilgi lerle aa k a ra b ilm e k te d ir. G e n e tik nsann genetik yapsnn allm as, dier prim atlar la ne kadar yakn akraba olduumuzu ortaya koyuyor. T abii ki insanlarn dier canllara olan yaknl sadece prim atlarla snrl deil. Dier canllarla da akrabayz, an cak genetik alm alar yoluyla hangi trlere yakn akraba

214

50 SORUDA YAAMIN TARH

KTLESEL YOK O L U U R

215

ek il, deri ren k tonu ya da gz rengi farkllk gsterir. B una ram en, bireylerin DNAlar yzde 9 9 ,9 orannda benzerdir. lk insan t rlerinin 6 m ilyon, m odern in san larn ise 2 0 0 .0 0 0 y llk b ir gem ii vardr. Benzer DNA dizisine sahip olm alar, A frikada evrilip dnyaya yaylan m odern in sann tek bir ortak atadan geldiini gsterir. T a rih le m e m e to tla r Fosillerin ve tarihncesinden kalma nesnelerin tarihlendirilm esi m etotlar sayesinde, bu kalntlarn gerek yalarn hesaplayabiliyoruz. Tem el fizik, kimya ve yerbi lim i tekniklerini kullanan bir dzineden fazla tarihlem e teknii, fosillerin ve kalntlarn bulunduu toprak taba kasnn tarihini bize syler. Bu konudan, yine evrim in ka ntlarndan sz ettiim iz 12. Soruda sz etm itik.

7. Blm KTLESEL YOK OLULAR

A Q I Kitlesel yok olu nedir? Dnya zerinde S I canllk hi yok oluun eiine geldi mi?
lk canlln dnya zerinde ortaya kndan gn m ze kadar geen m ilyarlarca y llk srede saysz trde canl yaam n srdrd. Gnm zde bile isim lendirilebilen canl tr says m ilyonlarla ifade edilirken, tarih boyunca ortaya km trlerin says o k daha fazladr. A ncak bu trlerin byk b ir blm gnm ze ulaa mad. Evrim sel srecin bir gereklilii olarak eski trler zaman ierisinde ortadan kalkarak, yeni gelen trler iin yaam alanlar brakrlar. Bu, doada bulunan varolu savann bir parasdr, uyum salayamayan trler orta dan kalkar. T rlerin bu ekilde zaman ierisinde ortadan kalkm alarna ksaca arkaplan yok olu u denir. Bunun yannda, ok ksa b ir sre ierisind e o k fazla canl t rnn ortadan kalkt zamanlar da yaanm tr. G em i 5 0 0 m ilyon y llk zaman ierisinde belirli dnem lerde canllarn yzde 5 0 -9 0 hzl b ir ekilde ortadan k alk m tr. Bu acm asz ve devasa olaylar ise k itlesel yok o lu olarak adlandrlr.

216

50 SORUDA YAAMIN TARH

KTLESEL YOK OLULAR

217

Kitlesel yok olular, dnya zerindeki canllarn b yk ounluunu ortadan kaldran lm cl olaylar olsa da, yeni gelecek canl trlerinin gelim esi iin olanak salam tr. rnein, dinozorlar 2 5 0 my gerekleen Perm iyen-Triasik yok oluundan sonra baskn hale geldi ler ve 65 my yine kitlesel bir yok olula ortadan k alkt lar. D inozorlardan boalan biyolojik alan, yeni baskn tr olan m em eliler tarafndan dolduruldu. Grld zere, kitlesel yok olular evrim sel adan olduka nem lidir. B e b y k k itle s e l y o k o lu Bilim dnyasnda yaygn olarak kabul gren be byk kitlesel yok olu tanm lanm tr. T rlerin sonunu getiren daha k k apta felaketler yaansa da, aada yazlan fe laketler devasa boyutlardadr ve dnya zerindeki can ll n sonunu getirm eye yaklam tr. Her biri meydana gel dii je o lo jik devrin sonunu getirerek yenisini am tr. O rd ovisiyen-Sil riyen D evri yok oluu: Gnm zden yaklak 4 4 0 -4 5 0 my meydana gelm itir. En byk ik in ci kitlesel yok olu olarak kabul edilm ektedir. Tm canl ailelerinin yzde 2 7 si ve cinslerin de yzde 5 4 yok ol m utur. D evoniyen D evri sonu y o k oluu: Gnm zden yak lak 3 6 0 -3 7 5 my meydana gelm itir. 20 m ilyon yl ka dar srm olabilir. Canl ailelerinin yzde 19u, cinslerin yzde 5 0 si ve tm trlerin yzde 7 0 i ortadan kalkm tr. P erm iyen-T riyas D evri yok oluu: Gnm zden yak lak 2 5 0 my meydana gelm itir. Meydana gelen en byk kitlesel yok olutur. Tm canl ailelerinin yzde 5 7 si, sinekler de dahil tm cin slerin yzde 8 3 (deniz ailelerinin yzde 5 3 ve cinslerin yzde 8 4 , tm deniz trlerinin yaklak yzde 9 6 s ve kara trlerinin de yzde 7 0 i) yok olm utur. Karalarda m em eli benzeri srngen lerin sonu gelmi ve om urgallarn kendini toparlam as 30 m ilyon yl alm tr. T riyas-Jura D evri yok oluu: Yaklak 2 05 my mey dana gelm i ve tm canl ailelerinin yzde 2 3 , cinslerin

m-,

Kitlesel yok olular

O O

1*

'

o ^ _1 8 / V )T3

' 1

1 * S
s

f\k/iw i i yok olular / W l i Arkaplandaki Alto


400 200

K I

>

\j^
V !

Milyon yl nce
ekil 1 4 3 . C anllk tarihi boyunca be byk kitlesel yok olu, canllar yok olm ann eiine getirmitir.

yzde 4 8 i (deniz ailelerinin yzde 2 0 si ve cinslerin yz de 5 5 i) yok olm utur. D inozor dnda arkosaur, terapsidlerin (m em elilerin atasdr) ve am fibilerin ou yok o l m utur. Karalar zerinde dinozorlar rakipsiz bir biim de yaamaya balam tr. K retase-T ersiyer D nem y ok oluu (K -T yok olu u): Gnm zden yaklak 6 5 -7 0 my meydana gelm itir. Tm canl ailelerinin yzde 17si, cinslerin yzde 5 0 si ve trlerin de yzde 7 5 i yok olm utur. Devam eden zam an da m em eliler ve kular baskn tr olarak yaylm tr. D i nozorlarn (kular h aricind e), yerkredeki trlerin te ikisiyle birlikte yok olmasyla nlenm i olan yok olutur. Fakat kk m em eliler, kaplumbaalar, tim sahlar, ku lar, kzlaalar ve pek o k hayvan grubu hayatta kalabil m itir. (ekil 143) K itle s e l y o k o lu u n n e d e n le ri Bilim insanlar, trlerin byk ounluunu yok olma noktasna getiren k itlesel felaketlerin nedenleri hakknda farkl teoriler ne srm tr. M eteor/kuyrukluyldz arpm as: Kitlesel yok olular iin ilk olaslk, Dnyaya arpan byk bir m eteor ya da

218

50 SORUDA YAAMIN TARH

KTLESEL YOK OLULAR

219

kuyrukluyldzdr. rnein, K retease-Tersiyer yok oluu nun nedeninin byk olaslkla b ir m eteor ya da kuyruk luyldz olduu dnlm ektedir. M eksikann Yucatan Yarmadas yaknlarndaki devasa boyutlardaki krater, yok oluun yaand zaman olan 65 my olum utur. Ta rihlerin tutuyor olm as, byk bir cism in Dnyaya arpa rak trler iin bir felaket oluturduu anlam na gelebilir. Benzer ekilde Perm iyen-Triyas yok oluunun nedeni de bir asteroid ya da buzdan bir kuyrukluyldz olabilir. Byle bir arpm a o kadar iddetli gerekleecektir ki, Dnya zerinde deprem ler, tsunam iler ve tm yzeyi dolaacak bir scak hava dalgasn tetikleyecektir. arp ma sonucu atm osfere yaylan scak toz bulutu geni bir alanda orm an yangnlarna yol aacaktr. Toz ve duman gne n aylar boyunca engelleyecek, sonu olarak fotosentez duracak, bitkiler ve bitkilerle beslenen can llar ksa bir srede lecektir. Dnya hzl bir soumaya girecektir. G kyznn tozdan tem izlenm esi sonrasnda, atm osferde asl kalan gazlar nedeniyle hzl bir snma gerekleecektir. Buzullam a: Kresel souma ve devasa buzulla rn gezegeni sarm as da kitlesel yok olua neden ola bilir. Tarihteki ikinci byk yok olu olarak bilinen O rdovisiyen-Silriyen Devri yok oluunun da olas nede ni, gnmzden 4 3 9 my meydana gelen buzullam adr. Kresel souma nedeniyle byyerek devasa boyutlara kan buzullar okyanuslardan suyu eker ve canllarn youn olarak yaad s su alanlarn tketirler. Karada da her yan kaplayan buzullar, g etme ans olmayan trlerin sonunu getirecektir. V o lk an ik ak tiv iteler: Dier b ir olaslk ise volkan pat lamalardr. Ancak kk apta b ir patlama yerine, b in lerce yl sren volkan aktivitesinden ya da sper volkan patlam asndan bahsediyoruz. rnein, Perm iyen-Triyas Devri sonunda, Sibiryada bir m ilyon yldan daha uzun b ir sre boyunca meydana gelen dev volkanik patlam a lar, Amerika Ktas byklnde bir blgede k ilom etre lerce kalnlkta lav ve kl katm anlar oluturm utur. Bu

dnem deki kitlesel yok oluun nedeni m eteor arpm as, volkan aktivitesi ya da dier bir etken olabilir. Ya da hep sinin de pay olabilir. G etiim iz 2 5 0 m ilyon yl boyunca daha kk boyuttaki birok volkan patlamas da kk apta kitlesel yok olulara neden olm utur. Patlam ayla or taya kan lavlar sonucu yanarak len canllar, yok oluun sadece kk bir ksm dr. Ancak patlamayla aa kan slfr gaz ve toz bulutlar atm osfere yaylarak dnyay evreler ve gne nn yzeye ulam asna engel olur. Asit yamurlar balar. lk balardaki soumay ar sn ma takip eder. Dengesiz iklim zellikleri b iro k trn so nunu getirecektir. O kyanuslarda o k sijen m iktarnn azalm as: Dier bir olaslk ise okyanuslarda ve zellikle s deniz sularndaki oksijen miktarnn azalmasdr. Anoksi (oksijen azalmas) denilen bu durum birok deniz canls iin boulma anla mna gelir. Ancak oksijensiz ortamda yaayan (dar hid rojen slfr veren) bakteriler gibi canllar ok rahat geliir ler. Hidrojen slfrn okyanusa yaylmas daha ok tr yok edecektir ve zamanla da atmosfere szarak karalardaki canllar iin de tehlike yaratacaktr. Ozon tabakasnn zarar grmesi zararl UV nlarnn yzeye gelmesine neden ola caktr. Bu tr bir oksijen azalmas durumu Permiyen Devri sonundaki yok oluun olas nedenlerindendir. M etan gaz: Gnmzde de tehlike oluturmaya devam eden bir dier etken ise ktasal tabakalarda bulunan tortu lardaki yksek m iktardaki m etan gazdr. Baz iklim bilim cilere gre gnmzde olduu gibi, okyanuslarda meydana gelen snma bu m etann atmosfere salnmasna neden ola bilir. Ortaya kan metan ve toksik gazlar kresel snmaya ve devamnda da kitlesel bir yok olua neden olabilir. Grld zere, dnya zerindeki can llk deimez (sabit) deildir. Yeni gelen trler yaam blgelerini igal eder ve deien artlara uyum saladklar srece varlk larn srdrrler. A ncak zaman ierisinde trler ortadan kalkar ve yerini yenileri alr. Kim i zamanlarda ise m ey dana gelen devasa felaketler nedeniyle tr saysnda ok hzl d yaanr.

220

50 SORUDA YAAMIN TARH

KTLESEL YOK O L U U R

221

50

Bugn 6. byk kitlesel yok oluun eiinde miyiz? Tehlike altndaki trlerin durumu nedir?

7. Soruda dnya zerindeki tanm lanan tr saysndan ve birok ayr soruda, ama zellikle 49. Soruda dnya zerinde yaanm kitlesel yok olulardan bahsetm itik. im di her iki konuyla da balantl ve bizi dorudan et kileyen bir soruya geelim : Bundan sonra ne olacak? Ba ka bir deyile dnya nereye gidiyor ve bu gidiin canllar zerine etkileri ne olabilir? Bugn bilim insanlar dnyada im diye kadar meydana gelen be byk kitlesel yok oluun ardndan, 6. yok olu un da gereklem ekte olduunu dnyor. Daha n ce k i kitlesel yok oluun nedenleri arasnda m eteor arpm a lar, sper volkan patlam alar ya da oksijen seviyesindeki deiiklikler gibi nedenler gsterilse de, bu seferki yok oluun sorum lusu dorudan biziz. 6. kitlesel yok olu biz insanlarn eseri ve imdiye kadar gerekleenlerin en hz ls. 2 1 0 0 ylm a geldiimizde insan aktiviteleri nedeniyle oluan kirlilik, orm an alanlarnn ykm ve denizlerdeki ar avlanma sonucunda, denizlerde ve karada nem li m iktarda trn sonu gelebilir. Bu gidie dikkat eken, benzer amalarla kurulan fark l boyutlarda birok organizasyon var. Bunlar arasnda en nem lilerinden bir tanesi Doa ve Doal Kaynaklarn Korunmas iin Uluslararas B irlik (IUCN; International U nion for Conservation o f Nature and Natural Resources). Kuruluun amac doann btnlnn ve canl eitlilii nin korunm as ve doal kaynaklarn adil ve ekolojik olarak srdrlebilir olm asn salamak ve bu ama dorultusun da toplumlar bilgilendirerek ynlendirmek. 1948 ylnda kurulan organizasyonda 89 devlet, 109 hkm et kurumu ve 8 0 0 den fazla hkm et d kurulu birlikte alyor. Organizasyon, durumumuzu gzel bir ekilde zetliyor ve gerekli uyarlan yapyor. Tabii ki buradaki soru, insanlk olarak zerimize deni gerektiince yapyor muyuz?

Organizasyonun ncelikli konular arasnda gsterdi i alanlar, bu gidii durdurm ak iin bize den grevleri vurguluyor: Biyoeitliliin ve ekosistem in korunm as iin yapl mas gerekenlere ncelik vermeliyiz, insanlar dnyada hkim tr olabilir, ancak kendi gelecekleri asndan ekosistem i korum ak ve iyiletirm ek zorundadrlar. Son yllarda ok ska karm za kan iklim deiik lii konusu, iklim de yaanan dzensizlik ve byk dal galanmalar hem bizi hem de dier canl trlerini tehdit ediyor. Doay koruyarak ve sera etkisi yaratan gazlarn salm m n azaltarak bu yolda atm atabiliriz. Srdrlebilir en erji iin toplum lar daha gvenli, do aya zarar verm eyen, ucuz ve sosyal olarak adil datlabi lecek en erji kullanm na doru gei yapmaldr. nsann yaam artlarn iyiletirm ek ve tabii ki bunu tm insanlara yaymak nceliklerim izden biri olmal. Yeil bir ekonom i yaratabilm eli; uygulanabilecek her alanda geri dnm l, doa dostu seenekleri tercih et meliyiz. Bunlar organizasyonun dikkat ektii ve ok acil bir ekilde uygulamaya konulm as zorunlu konulardr. Aa da bahsedilen Krm z Liste, dnya zerinde bulunan ve deerlendirm eye alnabilen teklike altndaki trleri liste liyor. Doa zerindeki etkim izi gsterm esi asndan ok nem li bir belgedir.

Krmz liste
Organizasyonun yaymlad Nesli Tkenm e Tehlikesi Altnda O lan T rlerin Krm z L istesi ( IUCN Red L ist) b inlerce tr ve alttrn neslinin tkenm e riskini ortaya koyuyor. Bu liste yoluyla, biyolojik eitlilik zerine etki mizi daha ak olarak anlayabiliriz. Listede geen 50 bine yakn tr zerine detayl bilgi toplanm akta ve durumlar belirlenm ektedir. D eerlendirilen trler farkl kategorilere ayrlm: EX (T k en m i), E W (Doal ortam nda tkenm i), CR (K ritik tehlikede), EN (T eh liked e), VU (H assas), N T (Neredeyse

222

50 SORUDA YAAMIN TARH

KTLESEL YOK O L U U R

223

ekil 144. Solda, Rothschild's zrafas (Tehlikede; Dnya stnde


4 7 0 taneden az sayda kald); ortada , A lotra G rebe (M adagaskar'n dalgkuu, son olarak 1985 ylnda grld, soyu tkendi); sada, papatya fam ilyasndan Cadiscus auaticus (Kritik tehlikede).

. ** >*
*1 *

1B

..

X.

tehdit altnda), LC (Asgari endie), DD (Yetersiz veri) ve NE: (Deerlendirilm em i Trler). (ekil 144) Konuya uzak olanlar iin bir hatrlatm a yapmakta fay da var. Burada bahsedilen binlerce canl deil, binlerce canl tr. Bu yzden ok daha fazla canldan bahsediyo ruz. Yok olm akla kastedilen, o tre ait tek bir bireyin bile dnyada artk bulunm am asdr. izelge 3 de organizasyonun 2 0 1 0 yl M art aynda ya ymlad veriler bulunuyor. 1 9 9 6 dan beri, alnan veriler her sene yenileniyor. imdiye kadar incelenen ve tehli kede olan trlerin says her yl art gsteriyor. Tabloda verilen tehlikedeki trler, kritik tehlikede (C R ), tehlikede (EN ) ya da hassas durumda (VU) olan trler. Bu, geri ka lan trlerin tehlike altnda olmad anlam na gelmiyor. Neredeyse tehdit altnda (N T) ve yetersiz bilgi (DD ) ie ren trler de ok sayda bulunuyor. Durum u detayl ola rak incelenebilen trlerin yzde 3 6 s tkenm e tehlikesi altnda ve bunun byk sorum lusu da bizleriz.

ekil 145. 2 0 0 5 yl
verilerine gre orm an alanlar.

i n O r m a n la r D i e r a a lk b lg e le r _ . D i e r a la n la r O k y a n u s la r

O rm a n la rn g e le c e i

Son birka yzyldr yaanan Sanayi Devrim i biz insan larn hayatlarn b iro k alanda kolaylatrsa da, orm anlar bu durumdan olum lu etkilenm edi, insan, artan nfusu ve bununla birlikte de artan ihtiyalar karlam ak iin do aya saldrdka, orm anlar da geriledi. u anda dnyada bulunan orm an alanlar, 20. yzyln banda bulunan or man alanlarnn yars kadardr. Birka yzyl geriye gi dersek, gnmzde olduundan ok daha fazla orm anlk alan olduunu grrz. (ekil 145) O rm an kayplarnn tem el nedenleri insan kaynakl dr. Ticari am al orman kesim i, yol ve demiryolu yapm, orm an yangnlar, alan m adenler, yaam ve tarm alan oluturm ak iin aa kesim i gibi nedenler orm an alanlar n bir yzyl ierisinde yarya indirdi. nsanlarn dnyada ki dier tr ve ekosistem ler zerine olan etkisini orm anla rn durum larndan kolayca gzlem leyebiliriz. (izelge 4) Son dnem lerde dnya apndaki duruma genel olarak baktm zda, gelimi lkelerde orm anlarn durum lar nn olum lu ynde gelitiini ancak azgelimi ve gelirin dk olduu blgelerde orman kayplarnn devam et

izelge 3: 2010 yl M a rt ayna kadar incelenen tr says ve tehlikedeki


trler.

savu

say
27.890

tmscys,
6,142

f :n ,V Wlv-,|S m M m H
% 10 %Z

i) N i .;f: V i i i((iii;(( il:


. . 821,212 12,189 , 8 ,4 9 5

) l;:
%

;:

A
70

1,740,830

47,978

17,315

224

50 SORUDA YAAMIN TARH M a

sonsz

225

6 3 5 412 iisil 7 3 4 .2 4 3

mm
21 .4 25 .8 4 .0 4 4 .3 32 .7 47 3 13.2 3 0 .3

Sonsz
Cevaplamaya altm z 50 soruyla, yaam n grkem li hikyesini gznzn nne serm eye altk. Evrenin, Gne Sistem in in ve Dnyann oluum undan dier geze genlerdeki yaam izlerine, en basit m olekllerin karm ak yapdaki hcreleri nasl oluturm u olabileceinden m il yonlarca trn bir a gibi dnyay sarm asna kadar birok farkl noktaya deindik. M ilyarlarca y llk bu hikyeye tek bir pencereden baktm zda, yaam n ne denli grkem li olabildiine arm am ak m m kn deil. Her geen gn yaplan keifler, yaam n ne kadar farkl ekillere girebil diini, dnya zerinde aklm za bile gelm eyecek yerlerde bile gelitiini ve eitlenerek yeni trleri ortaya kard n gsteriyor. Yaam, tarih boyunca b iro k defa tmden yok olm a tehlikesiyle karlasa da, h er zaman iin bir y o lunu bulm u ve yeni canl trleriyle yeni bir dzen k ura rak dnyaya yeniden yaylmtr. Bildiiniz gibi, 4 ,5 m ilyar y llk bu hikyenin sonlar na doru ise, doann sahip olduu bu dzeni bozm akta en baarl tr olan insanolu ortaya kt. Son sorum uzu iki tem el konu zerinde oluturduk. Yok olan trler ve orm anlarn durumu. Bu konular insann doa zerinde ki dorudan etkisini en net gsteren konulardandr. Ama konu listesini arttrabiliriz: iklim deiiklikleri, ozon ta bakasnn durumu, kirlenen sular, atm osferdeki kirlilik bizim doaya etkilerim izden sadece birkadr. 6. byk kitlesel yokolu ierisindeyiz ve bunun sorum lusu da dorudan bizleriz. Aklmzdan karmamamz gereken tem el nokta udur: Yaam sprizlerle doludur ve btn grkem i ve gzelliiy' le bizi artmaya devam edecektir, insanolu olarak bizler ise, bu gzellik ve dzen ierisinde ortaya km m ilyon larca trden sadece bir tanesiyiz. Sahip olduumuz farkl zellikler, bizi (yani insan) dier trlerden stn klmaz ya da dnyann efendisi yapmaz. Bu yzden, doann d zenini bozm adan, dier trlerle birlikte doann bir para s olarak yaamay renmemiz bizim iin kanlm azdr.

l i P l s l l S * 43 7 5 - 0 ,6 4 - 0 .1 7 0 .0 8 009 0 .0 0 - 0 .4 6 04 - 0 .2 2

4040 633 fc lif 661 -1 0 1 -4 4 8 3 25 -7 3 1 7

- 0 .6 2 0 09 0 .0 3 0 07 - 0 .0 1 - 0 .5 1 0 .2 0 .1 8

-1 2 7 5 34 877 17 -4 1 4 7 37 -8 8 6 8

H s i

4 3 .5 8 8 1 0 0 1 394 677 46 4 8 5 9 .9 2 5

1 0 .7 5 3 .9 5 2 .0 2 5

tiini gryoruz. Avrupa lkeleri ve Asyada in, nem li m iktarda orm an alan art yakalam durumda; ancak tm dnyay yakndan ilgilendiren Brezilyadaki tropik Amazon O rm anlarndaki kayplar sryor. G elirin dk olduu, kanuni dzenlem elerin olmad ya da zayf uyguland, korum a am al organizasyonlarn yeterince gelim edii blgelerde, orm anlarn korunm as insanlarn gndem lerinde ilk sralarda yer alm yor. Artan nfusla birlikte yeni yaam alanlarnn ve kereste rnle rinin ihtiyac da artyor. zellikle tarm , besicilik ve biyoyakt retim i iin orm anlar kesiliyor. G enele baktm zda, orm anlk alanlarn korunm as yolunda alm alar artsa da, orm an kayplarnn nne geilebilm i deildir. Birlem i M illetler Gda ve Tarm rgtnn yaymlad raporlar, dnyadaki orm anlarn durum unu ve iyiletirilm esi iin yaplmas gerekenleri aklyor. 2 0 0 9 ylnda aklanan son rapor, orm anlarn durum unu daha net olarak gzler nne koyacaktr. An cak bu sonular 1990 ylna kadar olan zam an kapsyor. Rapora gre, tm nlem lere kar orm an alanlarndaki ka yplar devam ediyor. zellikle Afrika ve Latin Am erikada kayplar daha hzl.

226

YAAM ZAMAN TABLOSU

KAYNAKLAR

227

Meteor bombardman

KAYNAKLAR
(K ay n ak olarak k u lla n la n tm in te rn e t w eb say falan 2 1 .0 2 .2 0 1 1 tarihind e k b n tro l ed ilm itir.)

Soru 1
- R ich ard D. Ja rra rd , S cien tific M eth od s: A n o n lin e b o o k ; 2 0 0 1 , http://em otionalcom petency.com /sci/booktoc.htm l - In tro d u ctio n to the S cien tific M eth od ; http://teacher.nsrl. rochester.edu/phy_labs/A ppendixE/A ppendixE.htm l

Soru 2
- C h ristop h er F. C hyba, K evin P. Hand, T h e Study o f the Living U n iv erse, Annu. Rev. Astron. Astrophys. 4 3 :3 1 - 7 4 , 2 0 0 5 . - D. J . Des M arais, M. R .W alter, E xp lo rin g the O rigins, E v o lu tio n , and D istrib u tio n o f Life in the U n iv erse, Annu. Rev. Ecol.

Syst., 3 0 :3 9 7 - 4 2 0 , 1 999.
- G. R. Ivan itsk ii, 2 1 st cen tu ry : W h a t is life from the perspective o f p h y sics?, P h y sics U sp ek h i,53 ( 4 ): 3 2 7 3 5 6 , 2 0 1 0 . - B ern ard La Scola vd., T h e virophage as a u n iqu e p arasite o f the giant m im iv iru s N ature 4 5 5 , 1 0 0 -1 0 4 , 4 Se p tem be r 2 0 0 8 . - C an llar D nyas: C an l n e d ir?; http://w w w .biltek.tubitak. gov.tr/bilgipaket/canlilar/canli_nedir.htm - Ja m e s O w en, V iru s-In fectin g V iru s F u e ls D e fin itio n o f Life D eb ate; http://new s.nationalgeographic.com /new s/2008/08/080822-giantviru s.h tm l - L ife; http://en.wikipedia.org/wiki/Life - L ife, A m erican H eritage D ictionary, 4. B asm , H ough ton M if flin C om pany; http://www.answers.com/topic/life

228

50 SORUDA YAAMIN TARH

KAYNAKLAR

229

- E u g lena g ra cilis; http://bio.rutgers.edu/euglena/Euglenas/ E g ra cili.h tm - eklin k a y n a :T y ran n o sau rs, F e e n ix x P u blish in g , In c; http://w w w .feenixx.com /prehistoric/tyrannosaur_dinosaurs_ p o ster.h tm

w iki/ C en tral_d og m a_of_m olecu lar_b iolog y - DNA and R N A "; http://www.dnaandrna.com/ - D N A -R N A -Protein; http://nobelprize.org/educational_games/ medicine/dna/ - DN A, RNA and P ro tein s; http://www.bioinform atics.org/ tutorial/ 1-1.h tm l Bu sorud a k u llan lan e k ille r N ation al H um an G en o m e R e search In stitu teden uyarlan m tr.

Soru 3
- A. J . G ooday vd., T races o f dissolved p articles, in clu d ing c o cco lith s, in the tests o f agglutinated fo ram inifera from the C h allen g er D eep ( 1 0 ,8 9 7 m w ater d epth, w estern equ atorial Pa c if ic ) , D eep Sea Research Part I: O ceanographic R esearch Papers, 5 7 ( 2 ) :2 3 9 - 2 4 7 , 2 0 1 0 . - N eil A. C am p bell, B io lo g y C o n cep ts & C o n n ectio n s S ix th E d i tio n ", s .2 -3 , 2 0 0 9 . - H eath er B eal, M icro b ial L ife in E x trem ely H ot E n v iro n m en ts, M o n tan a State n iv ersitesi; http://serc.carleton.edu/m icrobelife/ extrem e/extrem eheat/index.htm l - T h e In te rn e t A ncyclopedia o f S cien ce, H y p erth erm op h iles; http://ww w .daviddarling.info/encyclopedia/H/hypertherm o.html - T h e In te rn e t A ncyclopedia o f S cien ce, Dei nococcus radio-

Soru 6
- C arl W o ese and G eorge E. F o x ; P hy log enetic S tru ctu re o f the P rok ary o tic D om ain: T h e Prim ary K in g d o m s, Proceedings o f the

N ational A cadem y o f Science 7 4 :5 0 8 8 - 5 0 9 0 , 1 9 7 7 .


- E rn st M ayr, T w o E m p ires or T h r e e ? , Proceedings o f the N a

tional A cadem y o f Science 9 5 :9 7 2 0 - 9 7 2 3 , 1 9 9 8 .


- W . Ford D o o little, P hy log enetic C lassificatio n and the U n i versal T re e , V olu m e 2 8 4 , Nature 5 4 2 3 :2 1 2 4 - 2 1 2 8 , 2 5 H aziran 1999. - David B aum , R eading a P hy log enetic T ree: T h e M ean ing o f M o n o p h y letic G ro u p s, N ature Education 1, 2 0 0 8 . - Sandra K napp, W h a ts in a nam e? A h isto ry o f taxo n o m y , N atural H istory M u seu m , http://www.nhm.ac.uk/nature-online/ scien ce-of-n atu ral-h istory / taxon om y -sy stem atics/ h isto ry -taxo nom y/index.htm l - U nd erstan d ing E v olu tion , Sw itch in g to P h y lo g en etics; http:// evo lu tion.berkeley.edu/ evosite/ evol01/ H D lSw itch tophylos.htm l - U nd erstan ding E v olu tion , N ested H ierarch ies, th e O rd er o f N ature: C arolu s L in n aeu s; http://evolution.berkeley.edu/evolibrary/article/_0_0/history_05 - U nd erstan d ing E v olu tion , P h y log en etic sy ste m a tics; http://evolution.berkeley.edu/evolibrary/article/0_0_0/ p h y lo g e n e tics_ 0 1 - Laura K lap p enb ach, H ow A nim als and W ild life are C lassi fied ; http://animals.about.com /od/scientificdisciplines/a/classify in g anim .h tm - T ree o f Life W eb P ro je c t; http://tolweb.org/tree/phylogeny. htm l - C lad istics; http://en.wikipedia.org/wiki/Cladisdcs - B io lo g ical C lassificatio n s; http://en.wikipedia.org/wiki/Biolo g ical_classificatio n

durans ; http://www.daviddarling.info/encyclopedia/D/D_radiod u ran s.h tm l - T h e H igh Life: B ird s; http://audubonmagazine.org/birds/ b ird s0 0 1 1 .h tm l - E co sy stem ; http://en.wikipedia.org/wiki/Ecosystem - C o m m u n ity ; http://en.wikipedia.org/wiki/Comm unity

Soru 4
- F elisa W o lfe -S im o n vd., A B acteriu m T h at C an G row by U sing A rsen ic In stead o f P h o sp h o ru s, Science Express, 2 D e c .2 0 1 0 . - Life B u ilt W ith T o x ic C h em ical: F irst K now n M icrobe on E a rth A ble to T h riv e and R eprod uce U sin g A rsen ic; http:// w w w .scienced aily . com /releases/2010/ 12 / 1 0 1 2 0 2 1 4 0 6 2 2 . htm - A rsenik Sever B ak teriler H ayat Y en id en m i T an m lay acak ?; http://biyorss.com /?p=5074

Soru 5
- F . C rick , O n P ro tein S y n th esis, Symp. Soc. Exp. Biol. X II, 1 3 9 163, 1958. - F. C rick , "C en tra l dogm a o f m o lecu la r b io lo g y ", N ature 2 2 7 ( 5 2 5 8 ) :5 6 1 - 3 , A ustos 1 9 7 0 . - C en tral dogm a o f m o lecu lar b io lo g y ; http://en.w ikipedia.org /

230

50 SORUDA YAAMIN TARH

KAYNAKLAR

231

- K in g d om , http://en.w ikipedia.org/w iki/Kingdom _(biology)

- Ja m e s F. K astin g and David C atlin g, E v o lu tio n O f A H abitable P lan et, Annu. Rev. Astron. Astrophys. 4 1 :4 2 9 - 6 3 , 2 0 0 3 . - D. J . Des M arais, M. R .W alter, E x p lo rin g the O rig ins, E v olu tio n , and D istrib u tio n o f Life in the U n iv erse, Annu. Rev. E col.

Soru 7
- T h e W o rld C o n serv atio n U n io n . 2 0 1 0 . IU C N Red L ist o f T h rea ten ed Sp ecies. Sum m ary Statistics for G lobally T h re a t ened Sp ecies. T able 1: N um bers o f threaten ed sp ecies by m ajo r groups o f organism s ( 1 9 9 6 - 2 0 1 0 ) - E n viro n m en tal L iteracy C o u n cil, H ow M any Sp ecies are T h e re ? ; http://w w w .enviroliteracy.org/article.php/58.htm l

Syst. 3 0 :3 9 7 - 4 2 0 , 1 9 9 9 .
- C h ristop h er F . C hyba and K evin P. H and, T h e Stu dy o f the L iving U n iv erse, Annu. Rev. Astron. Astrophys. 4 3 :3 1 - 7 4 , 2 0 0 5 . - L .S. H ernan i M aia vd. O rig in o f L ife: R e ce n t C o n trib u tio n s to a S cien tific M o d el, C o pyright H. L. S. M aia, K. G. O rrell, I. V. R. D ias, 2 0 1 0 . - NASA, J e t P rop u lsion L aboratory, L ook in g for Lifes Sign a tu res; http://planetquest.jpl.nasa.gov/

Soru 8-12
- U nd erstan d ing E v olu tion ; http://evolution.berkeley.edu/evolibrary/hom e.php - Evrim i A nlam ak, http://evrimianlamak.Org/e/Ana_Sayfa - NAS B ook: Science, Evolution and Creationism ", N ation al A cad em y o f S c ien ce s, In stitu te o f M ed icin e, N ation al A cadem y P ress, W a sh in g to n , D C , 2 0 0 8 . - C. D arw in, On the Origin o f Species by M eans o f N atural S elec

Soru 15
- C h ristop h er F . C hyba and K evin P. H and, T h e Study o f the L iving U n iv erse, Annu. Rev. Astron. Astrophys. 4 3 :3 1 - 7 4 , 2 0 0 5 . - D. J . Des M arais, M. R .W alter, E x p lo rin g the O rig ins, E v o lu tio n , and D istrib u tio n o f Life in the U n iv erse, Annu. Rev. Ecol.

tion, o r the P reservation o f Favoured Races in the Struggle f o r Life,


1859. - J . A. C oyne, Sp eciation in a ctio n , Science 2 7 2 :7 0 0 - 7 0 1 , 1 996. - M ark Page, N atural selectio n 1 5 0 years o n , Nature, Vol 4 5 7 :8 0 8 - 8 1 1 , 12 $u b at 2 0 0 9 . - ekil K ayna: C .O . L ovejoy ve ark. T h e G reat Divides: A rdipith ecu s ram idus R eveals the P ostcran ia o f O u r L ast C o m m on A n cestors w ith A frican A pes, Science 3 2 6 :7 3 , 1 0 0 -1 0 6 , 2 0 0 9 . - n san evrim ind e y en i k eif A RD I: Ardipithecus ram idus, -A talarm zn a ta la r-, Bilim ve G elecek, S :6 9 , K asm 2 0 0 9 . - T b a bild irileri: http://www.tuba.gov.tr/duyuru.p h p ?id = 49 ve http://w w w .tuba.gov.tr/duyuru.php?id=50

Syst. 3 0 :3 9 7 - 4 2 0 , 1 9 9 9 .
- SET1 In stitu te, D rake E q u a tio n ; http://www.seti.org/Page. asp x?p id = 336. - T h e Search for Life O utsid e o f E arth ; http://w w w .chem .duke. edu/~jds/cruise_chem /Exobiology/search.htm l - L.S. H ernani M aia vd., O rigin o f Life: R ecen t C o n trib u tio n s to a S cien tific M o d el, C o pyright H. L. S. M aia, K. G. O rrell, I. V. R. D ias, 2 0 1 0 . - NASA F eatu red M ission s; http://www.nasa.gov/missions/index. htm l - S. Ig lesias-G roth , A. M an ch ad o, R. R eb o lo , J . I. G onzalez H er nandez, D. A. G arcia-H ern and ez, D. L. L am b ert; A nth racen e catio n s tow ard the P erseu s m o lecu lar co m p le x , M onthly N otices

Soru 13
- N atu ral H istory M u seu m , T h e search for life: A stro biolog y ; http://w w w .nhm .ac.uk/nature-online/space/planets-solarsystem /searchforlife-astrobiology/6 beyond -the-solar-system / in d e x .h tm l - NASA A strobiology: W h y is w ater so im p o rtan t for life?; http:// astrobiology.nasa.gov/ask-an-astrobiologist/question/?id=178 - O rig in o f W a te r o n E a rth ; http://en.wikipedia.org/wiki/Orig in _ o f_ w a ter_ o n _ E arth - W a te r; http://en.wikipedia.org/wiki/Water

o f the R oyal A stronom ical Society, M ayis 2 0 1 0 .


- A. B ello ch e, R. T . G arrod, H. S. P. M u ller, K. M . M en ten, C. C o m ito, and P. Sch ilk e; In creased co m p lex ity in in terstella r ch em istry : d etectio n and ch em ical m od elin g o f ethyl form ate and n -p rop y l cyanid e in Sgr B 2 (N ) , Astronomy & Astrophysics, V o lu m e 4 9 9 , N u m ber 1, 3 M ayis 2 0 0 9 . - A stronom er T o Search Sp ace F o r P recu rso rs O f L ife; http:// w w w .scienced aily.com / releases/ 2009/ 04/0904291 5 1 9 4 6 .h tm - Allan H ills 8 4 0 0 1 , http://en.wikipedia.org/wiki/ALH84001

Soru 1^

232

50 SORUDA YAAMIN TARH

KAYNAKLAR

233

- NASA, P la n et Q u est, E x o p lan et E x p lo ra tio n ; http://planetquest.jpl.nasa.gov/ science/science_in dex.cfm

- Ja m e s

F. K astin g and David C atlin g , E v o lu tio n O f A H abitable

P lan et, Annu. Rev. Astron. A strophys, 4 1 :4 2 9 - 6 3 , 2 0 0 3 . - D. J . D es M arais, M . R .W alter; E x p lo rin g the O rig ins, E v o lu tio n , and D istrib u tio n o f Life in the U n iv erse, Annu. Rev. Ecol. Syst. 3 0 :3 9 7 - 4 2 0 , 1 9 9 9 . - C h ristop h er

Soru 16-17
- Ian O N eill, T h e U niverse Is P recisely 1 3 .7 5 B illio n Years O ld ; http://new s.discovery.com /space/the-universe-is-precisely-1375b illio n -y ea rs-o ld .h tm l - NASA, B ig B ang C o sm olog y ; http://map.gsfc.nasa.gov/universe/bb_theory.htm l - NASA, T h e B ig B an g ; http://nasascience.nasa.gov/astrophysics/ w hat-pow ered-the-big-bang - NASA O fficial: Dr. G ary F . H inshaw , W ilk in so n M icrow ave A nisotropy P ro b e; http://wm ap.gsfc.nasa.gov - NASA, W h a t are th e orig in , ev o lu tio n and fate o f the U n i v erse?; http://nasascience.nasa.gov/big-questions/w hat-are-theorig in -ev o lu tio n -an d -fate-o f-th e-u n iv erse - B ig Bang; http://en.wikipedia.org/wiki/Big_Bang - T im e lin e o f B ig Bang; http://en.wikipedia.org/wiki/Timeline_ of_th e_B ig _B an g - NASA, U n iv erse; http://map.gsfc.nasa.gov/universe/uni_m atter.h tm l

F. C hyba and K evin P. H and, T h e Study o f the

L iving U n iv erse, Annu. Rev. Astron. A strophys, 4 3 :3 1 - 7 4 , 2 0 0 5 . - A lex N. H alliday, E a rth scien ce: In th e b e g in n in g ..., Nature 4 0 9 :1 4 4 - 1 4 5 , 11 O cak 2 0 0 1 . - E. G. N isb et, N. H. Sleep, T h e h ab itat and natu re of early life,

N ature 4 0 9 :1 0 8 3 - 1 0 9 1 , 2 2 u bat 2 0 0 1 .
- NASA, H ow did th e su n s fam ily o f p la n ets and m in o r b o d ies o rig in a te ? ; http://nasascience.nasa.gov/big-questions/how d id -th e-su n s-fa m ily -o f-p la n ets-a n d -m in o r-b o d ies-o rig in a te

Soru 20-21
- Bernard J . W o o d & A lex N. H alliday, C o olin g o f the E arth and co re form atio n after the giant im p a ct, N ature, V ol 4 3 7 :2 7 , E kim 2 0 0 5 . - E. G. N isbet, N. H. Sleep , T h e h ab itat and natu re o f early life ,

N ature 4 0 9 :1 0 8 3 - 1 0 9 1 , 2 2 u bat 2 0 0 1 .
- A lex N. H alliday, E arth scien ce : In th e begin ning . . 4 0 9 :1 4 4 - 1 4 5 , 11 O cak 2 0 0 1 . - Ja m e s

Soru 18
- K erem C a n k o a k , P a ra ck fizii ve k o z m o lo ji p ro blem lerin d e sim etri z erin e ; http://web.itu.edu.tr/~kcankocak/docs/keremca n k o ca k -L H C -sim etri.p d f - K erem C a n k o a k , C E R N d eki L H C d eneyleri hak k n d ak i ger e k le r ve yanl b ilin e n le r; http://web.itu.edu.tr/~kcankocak/ d o cs/ n tv-k erem -can k o cak -cern -y an lislar-d o gru lar.p d f - K erem C an k oak , K u ark larm k en d ili in d en m acerasnd a sim e tri ve sim etri k rn m ; http://web.itu.edu.tr/~kcankocak/docs/ co g ito -e v rim -k e rem -can k o cak .p d f - T b ita k , Avrupa N k leer A ratrm alar M erkezi: C E R N ; http://www. tubitak.gov. tr/sid/341/pid/0/cid/l 1239/index. h tm ;jse s s io n id = D 8 C 0 8 9 3 3 B A 9 C E 9 8 B B A 3 7 5 3 4 C D 4 C 0 F A 8 6

N ature

F. K astin g and David C atlin g , E v o lu tio n O f A H abitable

P lan et, Annu. Rev. Astron. Astrophys. 4 1 :4 2 9 - 6 3 , 2 0 0 3 . - D. J . D es M arais, M. R .W alter, E x p lo rin g th e O rigins, E v olu tio n , and D istrib u tio n o f Life in the U n iv erse, Annu. Rev. Ecol.

Syst. 3 0 :3 9 7 - 4 2 0 ,1 9 9 9 .
- C h ristop h er F . Chyba and K evin P. H and, T h e Study o f the L iving U n iv erse, Annu. Rev. Astron. Astrophys. 4 3 :3 1 - 7 4 , 2 0 0 5 .

Soru 22
- Ja m e s

F. K astin g and David C atling, E v o lu tio n O f A H abitable

P lan et, Annu. Rev. Astron. Astrophys. 4 1 :4 2 9 - 6 3 , 2 0 0 3 . - H erbert Palm e, T h e G ian t Im p act F o rm a tio n o f th e M o o n , Science, V o l 3 0 4 :9 7 7 - 9 7 9 , 14 M ays 2 0 0 4 . - B ernard J . W o o d & A lex N. H alliday, C o oling o f the E arth and co re form ation after the giant im p act , Nature, V o l 4 3 7 :2 7 , E kim 2 0 0 5 . - ek lin kayna http://civetm oon.deviantart.com /art/GiantIm p a ct-T h e o ry -3 2 6 7 0 3 6 1 ?q = b o o st:p o p u la r% 2 0 g ia n t% 2 0

Soru 19
- O . M an uel vd., T h e S u n s O rigin, C o m p o sitio n And So u rce O f E n e rg y ; http://www.umr.edu/~om/, 2 0 0 0 - T h ie rry M o ntm erle and Je a n -C h a rle s Augereau, Solar System F o rm a tio n and E arly E volu tion : the F irst 100 M illio n Y ears, 9 8 :3 9 - 9 5 , 2 0 0 6 .

234

50 SORUDA YAAMIN TARH

KAYNAKLAR

235

im p a ct& q o = 2 5

- L. S. H ernn i M aia vd., O rig in o f Life: R ecen t C o n trib u tio n s to a S cien tific M o d el, C o p y rig h t H. L. S. M aia, K. G . O rrell, I. V. R. Dias, 2 0 1 0 .

Soru 2 3 -2 4
- D aniele L. P in ti M . G argaud vd., T h e O rig in and E v olu tion o f the O ce a n s, Lectures in A trobiology, V ol. 1 :8 3 -1 1 2 , Sp ringerVerlag B erlin H eidelberg, 2 0 0 5 . - Ja m e s F . K astin g and David C atlin g , E v o lu tio n O f A H abitable P lan et, Annu. Rev. Astron. Astrophys. 4 1 :4 2 9 - 6 3 , 2 0 0 3 . - O cean s: C h em istry and L ife; http://www.chem.duke.edu/~jds/ cruise_chem / oceans/oceanintro.htm l

Soru 2 9
- D. J . D es M arais, M. R .W alter, E x p lo rin g the O rig ins, E v o lu tio n , and D istrib u tio n o f Life in th e U n iv erse, Annu. Rev. Ecol.

Syst. 3 0 :3 9 7 - 4 2 0 , 1 9 9 9 .
- D avid L. A lls, S tro m a to lite s, W e ste rn W a sh in g to n U n iv er sity , 2 0 0 9 ; http://fire.biol.w w u.edu/trent/alles/Strom atolites. pdf - L. S. H ern an i M aia vd., O rigin o f L ife: R ecen t C o n trib u tio n s to a S cien tific M o d el, C opyright H. L. S. M aia, K. G. O rrell, I. V. R. D ias, 2 0 1 0 .

Soru 2 5
- Ja m e s F . K astin g and David C atlin g , E v o lu tio n O f A H abitable P lan et, Annu. Rev. Astron. Astrophys. 4 1 :4 2 9 - 6 3 , 2 0 0 3 . - Step h en J . M o jzsis, Life and the E v o lu tio n o f E arth s A tm o sp h ere, Science, V o l. 2 9 6 , 5 5 7 0 :1 0 6 6 - 1 0 6 8 , 10 M ayis 2 0 0 2 .

Soru 30
- D. J . D es M arais, M. R .W alter, E x p lo rin g the O rig ins, E v o lu tio n , and D istrib u tio n o f Life in the U n iv erse, Annu. Rev. Ecol. Syst. 3 0 :3 9 7 - 4 2 0 ,1 9 9 9 . - David W . D eam er, T h e F irst L iving System s: a B io en erg e tic P ersp ective, M icrobiology And M olecular B iology Reviews, s .2 3 9 2 6 1 , H aziran 1 997. - P eter E . N ielsen , A New M o lecu le o f L ife ?, Scientific A m erican 2 9 9 , 6 4 -7 1 , 2 0 0 8 . - P lan k en stein er K, R ein er H, R ode B. M ., F ro m earth s p rim i tive atm osph ere to ch iral p e p tid e s -th e orig in o f p recu rsors for life , C h em B iod ivers, 1 ( 9 ) :1 3 0 8 - 1 5 ., Eyl l 2 0 0 4 . - L. S. H ernn i M aia vd., O rig in o f Life: R e ce n t C o n trib u tio n s to a S cien tific M o d el, C o pyright H. L. S. M aia, K. G. O rrell, 1. V. R. D ias, 2 0 1 0 .

Soru 2 6
- E v olu tion o f the co n tin en tal cru st, C. J . H aw k esw o rth l & A. I. S. K em p, V ol 4 4 3 :1 9 , 8 1 1 - 8 1 7 , E kim 2 0 0 6 . - ek lin kayna http://www.divediscover.whoi.edu/tectonics/ tecto n ics-su b d u ct.h tm l - U nd erstan ding E v olu tion , B iogeography: W allace and W e g en er; http://evolution.berkeley.edu/evolibrary/article/0_0_0/ h isto ry _ 1 6 - U niv ersity o f C aliforn ia M useum o f P aleo n tolo gy , G eological T im e s; http://ww w .ucm p.berkeley.edu/help/tim eform .htm l - A lfred W eg en e r; http://en.wikipedia.org/wiki/Alfred_W egener - NASA, Plate M o vem en ts; http://scign.jpl.nasa.gov/learn/plate. htm

Soru 2 7
- E. G. N isbet, N. H. Sleep , T h e hab itat and natu re o f early life,

Soru 31
- O r J . F o x S. W . ed., O rig ins o f P reb io lo g ical System s and o f T h e ir M o lecu lar M atrices, N ew Y o rk A cad em ic P ress., ss .1 3 7 , 1967. - Adam P. vd., T h e M iller V o lca n ic Sp ark D ischarge E xp eri m en t, V ol 3 2 2 , Science 4 0 4 , 17 E k im 2 0 0 8 . - L.S. H ernn i M aia vd., O rigin o f Life: R ecen t C o n trib u tio n s to a S cien tific M o d el, C opyright H. L. S. M aia, K. G. O rrell, L V. R. D ias, 2 0 1 0 . - ek lin kayna; http://www.blc.arizona.edu/courses/ schaffer/182/U rey-M iller.htm

N ature 4 0 9 :1 0 8 3 - 1 0 9 1 , 2 2 u bat 2 0 0 1 .
- David W . D eam er, T h e F irst Living System s: a B io en ergetic P ersp ectiv e , M icrobiology And M olecular Biology Reviews, s .2 3 9 - 2 6 1 , H aziran 1 9 9 7 . - U niversity o f C aliforn ia M u seu m o f P aleo n tolo gy , G eological T im e s; http://ww w .ucm p.berkeley.edu/help/tim eform .htm l - ek lin kayna; http://encyclopediaurantia.org/graphictim e.htm

Soru 2 8
- E. G. N isbet, N. H. Sleep , T h e h ab itat and natu re o f early life,

N ature 4 0 9 :1 0 8 3 - 1 0 9 1 , 2 2 ubat 2 0 0 1 .

236

50 SORUDA YAAMIN TARH

KAYNAKLAR

237

Soru 32
- Carl Z im m er, O n the O rigin o f Life o n E a rth , Vol 3 2 3 , Sci

Soru 35
- R ich ard E. M ich od a vd., L ife-h istory ev o lu tio n and th e orig in o f m u lticellu larity , Jo u r n a l o f T h e o re tica l B iolog y ; 2 3 9 ( 2 ) :2 5 7 7 2 , 21 M art 2 0 0 6 . - J o h n T y ler B o n n er, T h e O rig ins o f M u lticellu la rity , Integra

ence, 1 9 8 - 1 9 9 , 9 O cak 2 0 0 9 .
- N iles L eh m an , RNA in ev o lu tio n , W iley Interdisciplinary Reviews - RN A V o lu m e 1, Issu e 2 , 16 T em m u z 2 0 1 0 . - A lonso R icard o and J a c k W . Szostak, T h e O rig in o f Life on E a rth , Scientific A m erican M agazine, E yl l 2 0 0 9 . - L. S. H ernn i M aia vd., O rig in o f Life: R ecen t C o n trib u tio n s to a S cien tific M o d el, C opyright H. L. S. M aia, K. G. O rrell, 1. V. R. D ias, 2 0 1 0 . - C a rl Z im m er, W h a t C am e B efo re D N A ?, D iscov er M aga

tive B iology: Issues, News, and Reviews, V o lu m e 1, Issu e 1, s .2 7 36, 1998. - N ico le K in g, T h e U n icellu lar A ncestry o f A nim al D evelop m e n t, D evelopm ental Cell, Vol. 7, 3 1 3 - 3 2 5 , E yl l, C opyright by C ell P ress, 2 0 0 4 . - Sch o p h J . W ., M icro fo ssils o f the early A rch ean ap ex ch ert: N ew eviden ce o f th e an tiqu ity o f life . Science 2 6 0 :6 4 0 - 6 4 6 , 1993. - D ale K aiser, B u ild ing A M u lticellu lar O rg an ism , Annu. Rev.

zin e, H a z ira n 2 0 0 4 ; http:/ / discoverm agazine.com / 2004/ jun/


co v er - E xp lorin g Lifes O rigins; http://exploringorigins.org/ - R obert Sh apiro, A Sim p ler O rig in for L ife; http://www.scientificam erican .com / article.cfm ?id = a-sim p ler-orig in -for-life

G enet., 3 5 :1 0 3 - 2 3 , 2 0 0 1 .

Soru 3 6
- E. G. N isbet, N. H . Sleep, T h e h a b ita t and natu re o f early life ,

Soru 3 3
- David W . D eam er, T h e F irst L iving System s: a B io en ergetic P ersp ectiv e, M icrobiology And M olecular B iology Reviews, s .2 3 9 2 6 1 , H aziran 1 9 9 7 . - C arl Zim m er, O n the O rigin o f Life o n E a rth , Science, Vol: 3 2 3 :1 9 8 - 1 9 9 , 9 O cak 2 0 0 9 . - J a c k W . Szostak, O rig ins O f Life: System s ch em istry o n early E a rth , N ature, V ol 4 5 9 : 1 7 1 -1 7 2 , 1 4 M ayis 2 0 0 9 . - A lonso R icardo and J a c k W . Szo stak , T h e O rigin o f Life on E a rth Scientific A m erican M agazine, Eyl l 2 0 0 9 . - L .S. H ernn i M aia vd. O rig in o f L ife: R ecen t C o n trib u tio n s to a S c ie n tific M odel, C o pyright H. L. S. M aia, K. G. O rrell, I. V. R. D ias, 2 0 1 0 . - ek lin kayna: J . Szo stak vd., T em p late-d irected sy n th e sis o f a g en etic p olym er in a m od el p ro to ce ll, Nature, 4 5 4 ( 7 2 0 0 ): 1 2 2 -5 , H aziran 2 0 0 8 . - E x p lo rin g L ifes O rig ins; http://exploringorigins.org/

N ature 4 0 9 :1 0 8 3 - 1 0 9 1 , 2 2 u bat 2 0 0 1 .
- C arl Z im m er, O n the O rig in o f E u k a ry o tes, Science, V o l 3 2 5 : 6 6 6 - 6 6 8 , 7 A ustos 2 0 0 9 . - J . A. L ake, T h e ev o lu tio n o f eu k a ry o tes, Science 2 7 ;3 1 6 ( 5 8 2 4 ) :5 4 2 - 3 , N isan 2 0 0 7 . - T. M artin E m b ley , E u k ary o tic ev o lu tio n , ch anges and ch a l len g es, N ature 4 4 0 , 6 2 3 - 6 3 0 , 3 0 M art 2 0 0 6 . - S co tt D aw son, C reatu res from the B la ck Lagoon: L esso n s in the D iversity and E v o lu tio n o f E u k a ry o tes; http://evolution. berkeley.edu/evosite/resources/readings_daw son.shtm l - E volu tion ary h isto ry o f life ; http://en.wikipedia.org/wiki/Evolu tio n a ry _h isto ry _o f_life# E arliest_ ev id en ce_ fo r_ life _ o n _ E a rth

Soru 3 7
- J i n X io n g C arl E. Bauer, C o m p lex E v o lu tio n O f P h o to sy n th e sis, Annu. Rev. Plant Biol. 5 3 :5 0 3 - 2 1 , 2 0 0 2 . - E. G. N isbet, N. H . Sleep , T h e h ab itat and natu re o f early life ,

Soru 3 4
- A neil F . Agrawal, E v o lu tio n o f Sex: W h y Do O rganism s Sh u ffle T h eir G en o ty p es?, Current B iology, 16, R 6 9 6 -R 7 0 4 , 5 E yl l 2 0 0 6 . - C arl Zim m er, O n th e O rig in o f Sexu al R ep ro d u ctio n , V ol 3 2 4 , Science, 1 2 5 4 -1 2 5 6 , 5 H aziran 2 0 0 9 .

N ature 4 0 9 ,1 0 8 3 - 1 0 9 1 , 2 2 u bat 2 0 0 1 .
- M itch L eslie, O n the O rigin o f P h o to sy n th e sis, Science, V o l, 3 2 3 :1 2 8 6 - 1 2 8 7 , 6 M art 2 0 0 9 . 1 6 4 ) J in X io n g vd ., M o lecu lar E vid ence for th e Early E v olu tion o f P h o to sy n th esis, Science, 2 8 9 , 1 7 2 4 , 2 0 0 0 . - R ich ard A .K err, T h e Sto ry o f 0 2 , Science, V o l 3 0 8 : 1 7 3 0 -

238

50 SORUDA YAAMIN TARH

KAYNAKLAR

239

1 7 3 2 , 17 H aziran 2 0 0 5 .

evolution.berkeley.edu/evolibrary/article/_0_0/cam brian_01 - U niv. o f C aliforn ia M useum o f P aleontology , T h e C am brian P eriod ; http://w w w .ucm p.berkeley.edu/cam brian/cam b.htm l

Soru 3 8
- Ja m e s F. K astin g and David C atling, E v o lu tio n O f A H abitable P lan et, Annu. Rev. Astron. Astrophys. 4 1 :4 2 9 - 6 3 , 2 0 0 3 . - E. G. N isb et, N. H. Sleep, T h e habitat and n atu re o f early life,

Soru 40
- Raven, J.A . vd., R oots: evolu tionary orig in s and b io g e o ch e m i cal sig n ifican ce, Jou rn al o f Experim ental Botany 5 2 :3 8 1 - 4 0 1 ,

N ature 4 0 9 , 1 0 8 3 - 1 0 9 1 , 2 2 u bat 2 0 0 1 .
- R ich ard A .K err, T h e Story o f 0 2 , Scien ce , V o l 3 0 8 : 1 7 3 0 1 7 3 2 , 1 7 H aziran 2 0 0 5 . - G. C. D ism u k es vd., T h e o rig in o f atm o sp h eric oxygen on E arth : T h e in n o v atio n o f ox y g en ic p h o to sy n th esis, PNAS, Vol 9 8 : 2 1 7 0 - 2 1 7 5 , 2 7 u bat 2 0 0 1 . - T im o th y M . L en to n , T h e co u p led ev o lu tio n o f life and a tm o sp h eric o x y g en , Evolution Planet E arth , A cad em ic Press Lim ited , s.3 3 , 2 0 0 2 . - Paul G. F a lk o w sk i and Y u k io Isozak i, T h e Story o f 0 2 , S c i ence, V o l 3 2 2 :5 4 0 - 5 4 2 , 2 4 E kim 2 0 0 8 . - H e in rich D H olland, T h e oxy g en atio n o f the atm o sp h ere and o c e a n s, P hil. T ran s. R. Soc. B 3 6 1 :9 0 3 - 9 1 5 , 2 0 0 6 . - J a s o n R aym ond, T h e E ffect o f O xy g en o n B io ch em ical N et w ork s and the E v o lu tio n o f C o m p lex L ife, Science, V o l.3 1 1 , N o: 5 7 6 8 :1 7 6 4 - 1 7 6 7 , 2 4 M art 2 0 0 6 . - V icto r J . T h a n n ick a , O xygen in the E v olu tion o f C o m p lex Life and the P rice W e Pay, A m erican Jou rn al O f Respiratory Cell And

2001 .
1 8 4 ) G eiser H eck m an vd., M o lecu lar ev iden ce for the early co l on izatio n o f land by fungi and p la n ts, Science 2 9 3 ( 5 5 3 2 ): 1 1 2 9 1 1 3 3 , A gustos 2 0 0 1 . - P. K n au th vd., T h e late P recam brian g reen in g o f the E a rth ,

N ature 4 6 0 ( 7 2 5 6 ) :7 2 8 - 7 3 2 , A gustos 2 0 0 9 .
- C. H. W ellm a n vd., F rag m en ts o f th e earliest land p lan ts,

N ature 4 2 5 ( 6 9 5 5 ) :2 8 2 - 2 8 5 , 2 0 0 3 .
- O sb orn e, C. P. vd., Review . N atures green revolu tion: the re m arkable evo lu tio nary rise o f C 4 p la n ts, P hilosophical T ransac

tions: B iological Sciences 3 6 1 ( 1 4 6 5 ) :1 7 3 - 1 9 4 , 2 0 0 6 .


- U niversity o f C aliforn ia M u seu m o f P aleontology , G eolo gical T im e s; http://w w w .ucm p.berkeley.edu/help/tim eform .htm l - T h e E v olu tion o f P lan ts; http://www.xs4all.nl/~steurh/engplant/ e b la d l.h tm l - U niversity o f C alifo rn ia M u seu m o f P aleontology , T h e P erm ian ; http://ww w .ucm p.berkeley.edu/perm ian/perm ian.htm l - E volu tion ary H istory o f P lan ts; http://en.wikipedia.org/wiki/ E v olu tion ary _h istory _o f_p lan ts - T h e E v olu tion o f L and P lan ts; http://www.world-builders.org/ lessons/less/les8/Vles8r.html - U niversity o f C alifo rn ia M u seu m o f P aleontology , T h e C ar b o n ifero u s; http://ww w .ucm p.berkeley.edu/carboniferous/ carb o n ifero u s.h tm l

M olecular B iology, V ol 4 0 :5 0 7 - 5 1 0 , 2 0 0 9 .
- ek lin kayna: O zon e H ole W a tc h ; http://ozonew atch.gsfc. nasa.gov/

Soru 3 9
- Lars S. Je rm iin , L eo n P oladian, M ich ael A. C h arleston , Is the Big B ang in A nim al E v o lu tio n R e a l? Science, V ol 3 1 0 :1 9 1 0 1 9 1 1 , 2 3 A ralk 2 0 0 5 . - C h arles R. M arsh all, E xp lain in g th e C am brian E x p lo sio n of A n im a ls, Annu. Rev. E arth Planet. Sci. 3 4 :3 5 5 - 8 4 , 2 0 0 6 . - Ja m e s W . V alen tin e, P relu d e T o T h e C am brian E x p lo sio n ,

Soru 41
- NAS B ook : S cie n ce , E v olu tion and C rea tio n ism N ational A cadem y o f Scie n ce s, In stitu te o f M ed icin e, N ation al A cadem y Press, W a sh in g to n , D C , 2 0 0 8 . - U nd erstan d ing E v olu tion , W h a t h as the head o f a cro cod ile and the gills o f a fish ?; http://evolution.berkeley.edu/evolibrary/new s/060501_tiktaalik

Annu. Rev. E arth Planet. S ci. 3 0 :2 8 5 - 3 0 6 , 2 0 0 2 .


- P BS, T h e C am brian E x p lo sio n ; http://www.pbs.org/wgbh/ evolution/library/03/4/l_034_02.htm l - T b ita k , Je o lo jik D ev irler; http://ww w .biltek.tubitak.gov.tr/ bilgipaket/jeolojik/K am brO ncesi/index.htm - U n d erstan d in g E v olu tion , M eet th e C am brian C ritters; http://

Soru 42-44
- Paul C. Seren o , T h e E v o lu tio n o f D in osau rs, S cie n ce 2 8 4 ,

240

50 SORUDA YAAMIN TARH

KAYNAKLAR

241

21 3 7 ; 2 1 3 7 -2 1 4 7 , 1999. - S.C . W a n g vd ., E stim atin g the D iversity o f D in o sau rs,

A cadem y o f S cien ces, In stitu te o f M ed icin e, N ation al A cadem y Press, W ash in g to n , D C , 2 0 0 8 . - David L. A lles, A Review o f C u rren t R esearch o n H um an E volu tion : T each in g H um an E v o lu tio n ., The A m erican Biology

Proceedings o f the N ational A cadem y o f Sciences USA 103


( 3 7 ): 1 3 6 0 1 - 1 3 6 0 5 , 2 0 0 6 . - N. M acL eod vd,. T h e C reta ceo u s-T ertia ry b io tic tra n sitio n ,

Jou rn al o f the G eological Society 1 5 4 (2 ): 2 6 5 - 2 9 2 , 1 9 9 7 .


- Scien ced aily , M ass E x tin ctio n s And T h e E volu tio n O f D in o sa u rs; http://www.sciencedaily.com/ releases/ 2008/ 09/ 0809301 0 2 6 3 1 . htm - D inod atabase, T h e Age o f D in o sau rs; http://www.dinodata base.com / - N ation al G eop g rap hic, P reh isto ric T im e L in e ; http://science. nationalgeographic.com / science/p rehistoric-w orld/prehistoric tim e-line/ - N atural H istory M u seu m , D in osau rs and o th er e x tin ct cre a tu re s; http://www.nhm.ac.uk/nature-online/life/dinosaursoth er-extin ct-creatu res/ in d ex.h tm l - Sm ith so n ia n N ation al M u seu m o f N atural H istory, O rigin of M am m als; http://paleobiology.si.edu/geotime/main/htmlversion/ tria ssic4 .h tm l - e k lin kayna; http://w w w .britannica.com /EBchecked/topica rt/ 66391/62499/ - ek lin kayna; S tep h en L. B ru satte, T h e orig in and early rad iation o f d in osau rs, E arth-Science Reviews, V o l.1 0 1 , Issues 1 -2 , s .6 8 - 1 0 0 , T em m u z 2 0 1 0 . - C h icx u lu b Im pact - No M ass E x tin ctio n ; http://geoweb.prmceton.edu/people/keller/M ass_Extinction/m assex.h tm l# 8

T eacher, V o l.6 5 , N o .5(M ay is): 3 3 3 - 3 3 9 , 1 -6 5 , 2 0 0 3 .


- Sm ith so n ian N ational M useum o f N atural H istory, W h a t does it m ean to be h u m an ?; http://humanorigins.si.edu/ - B radshaw F ou n d atio n in co llab o ra tio n w ith Steph en O ppenheim er, Jo u rn e y o f M an k in d ; http://www.bradshawfoundation. com/journey/ - U nd erstan d ing E v olu tion , F o ssil H om in id s, H u m an E volu tion : T h o m as H u xley & Eugene D u b o is; http://evolution.berkeley. edu/evolibrary/article/history_17 - U nd erstan d ing E v olu tion , H um an ev o lu tio n ; http://evolution. berkeley.edu/evolibrary/article/0_0_0/hum anevo_01

Soru 4 9
- E vrim i A nlam ak, K itlesel Y o k o lu la r; http://evrim ianlam ak. org/e/ E vrim _101Y :K itlesel_yokolu % C 5% 9Flar - David Jab lo n sk i-U n d erstan d in g E v olu tion , H ow to survive a m ass e x tin c tio n ; http://evolution.berkeley.edu/evolibrary/article/ jablonski01 - U nd erstan d ing E volu tion , E x tin ctio n s: G eorges C u vier; http://evolution.berkeley.edu/evolibrary/article/history_08 - N ation al G eograp hic, M ass e x tin ctio n s: W h a t cau ses anim al die o ffs?; http://science.nationalgeographic.com /science/prehistoric-w orld/m ass-extinction/ - PBS, M ass E x tin c tio n ; http://www.pbs.org/wgbh/nova/ scien cenow /3318/ 01-su sp-nf.htm l

Soru 45
- K en n eth D. R ose, T h e B egin ning o f the Age o f M am m als, T he Jo h n s H op k ins U niversity Press, B altim o re, 1 993. - Sm ith so n ian N ation al M useum o f N atural H istory, M am m al F a m ily ; http://www.mnh.si.edu/m am mals/index.htm - Sm ith so n ian N ation al M u seu m o f N atural H istory, O rigin of M am m als; http://paleobiology.si.edu/geotime/main/htmlversion/triassic3 .htm l - e k lin kayna; C arl B u ell, At the W a te rs E dge by C arl Zim m er, 1 9 9 8 .

Soru 50
- T h e W o rld C o n servatio n U n io n . 2 0 1 0 . IU CN Red L ist of T h reaten ed Sp ecies. Sum m ary Statistics for G lobally T hreaten ed Sp ecies; http://www.iucn.org/what/, http://www.iucnredlist.org/ d ocu m en ts/sum m arystatistics/2010 _ 1 R L_Sta ts_ T a b le_ 1 .p d f, http://ww w .iucnredlist.org/about/red-list-overview - F oo d and A gricultural O rg an ization o f the U nited N a tio ns, State o f the W o rld F o rests 2 0 0 9 ; http://www.fao.org/ docrep/01 l/ i0350e/ i0350e00.h tm - ek lin kayna; http://foris.fao.org/static/data/fra2005/ maps/2.2.jp g

Soru 46-48
- NAS B o o k : S cie n ce, E v o lu tio n and C reatio n ism , N ation al

50 SORUDA DZS LK PAKET: 13 KTAP


50 Soruda nsann Tarihncesi Evrimi Prof. Dr. Metin zbek 50 Soruda Aydnlanm a Afar Timuin - Ati Timuin 50 Soruda Grelilik Kuramlar Yard. Do. brahim Semiz 50 Soruda Deprem Prof. Dr. Haluk Eyidoan 50 Soruda BUyk Patlama Kuram Prof. Dr. Metin Hotinli 50 Soruda Yerin Evrimi Prof. Dr. Mehmet Sakn 50 Soruda Yaamn Tarihi Dr. Deniz ahin 50 Soruda Arkeoloji Prof. Dr. Mehmet zdoan 50 Soruda Matem atik Prof. Dr. ahin Koak 50 Soruda Evren alar Sunay 50 Soruda Darwin ve Evrim Kuram Prof. Dr. Haluk Ertan 50 Soruda Bilim ve Bilimsel Yntem Ed. Alaeddin enel 50 Soruda Kuantum Kuram ve Nanoteknoloji Prof. Dr. Tekin Dereli Prof. Dr. Glay Dereli

50 Soruda Dizisine abone olabilirsiniz.

'50 Soruda' dizisi

Bylelikle kitaplar % 40'a varan indirimlerle alabilirsiniz. Kitaplarn kp kmadn takip etmeniz gerekmez, her kitap ktktan sonra bir hafta iinde adresinize herhangi bir cret talep edilmeksizin ulatrlr. Yl iinde oluacak fiyat farklarndan etkilenmezsiniz.

50 SORUDA DZS KNC PAKET: 10 KTAP


50 Soruda Molekler Evrim Do. Dr. Ergi Deniz zsoy 50 Soruda Jeoloji Prof. Dr. A. M. Celal engr 50 Soruda Hz. Muhammed ve Kuran Yard. Do. Dr. Haan Aydn 50 Soruda Antropoloji Do. Dr. Sibel zbudun Dr. Glfem Uysal >50 Soruda Maddenin Evrimi Do. Dr. Kerem Cankoak 50 Soruda Psikiyatri Prof. Dr. Ali Nahit Babaolu 50 Soruda Enerji Kaynaklarmz Prof. Dr. Osman Demircan 50 Soruda Genler ve Genetik Dr. Kenan Ate 50 Soruda Avrupamerkezcilik Ender Helvacolu 50 Filmde Trkiye Sinema Tarihi Zahit Atam

Abone olmak iin yaynevimizle iletiime geiniz.


Bilim ve Gelecek Kitapl Moda C . Zuhal Sk. No: 9/1 Kadky-stanbul Tel: 0216.349 71 72 http://www.bilimvegelecek.com.tr bilgi@bilimvegelecek.com.tr

evrimi

insann tarihncesi evrimi Metin zbek

yerin evrimi Mehmet Sakn

50 Soruda nsann Tarihncesi Evrimi a d l k i t a b n d a ,

50 Soruda Yer'in Evrimi'n d e , Prof. Dr. Mehmet Sakn,

Prof. Dr. Metin zbek, in s a n n e v r i m i n i , c a n l l a r d n y a s n d a k i u z a k v e y a k n a k r a b a la r y la b e n z e r lik le r in in v e f a r k l l k l a r n n iz in i s r e r e k a n l a t y o r . H a c e t t e p e n iv e rs ite s i A n tr o p o lo ji B l m B a k a n o la n y a z a rn , in s a n e v r i m i n i n b i y o l o j i k v e k l t r e l a d m l a r n t a k i p e d e r k e n u r a d s o r u l a r d a n k i m i l e r i y le : nsann evrimini hangi bilim dal ele alr? in s a n m a y m u n d a n m g e l m i t i r ? Ne zaman iki ayak zerinde yrmeye baladk? e m p a n z e l e r l e s o n o r t a k a t a m z k i m d i ? ilk a t a l a r m z b i z e n e k a d a r b e n z i y o r d u ? lk aletler ne kadar eskidir? i n s a n n e z a m a n k o n u m a y a b a l a d ? Fosillerde konuma yetenei nasl anlalr? A t a l a r m z A f r i k a ' d a n ilk n e z a m a n k t la r ? nsan atei ne zaman kefetti? N e a n d e r t a l ' l e r b i z i m a t a m z m y d ? Neandertal'lerden mi geliyoruz, Kromanyon'lardan m? G e n e t i k t e k i g e l i m e l e r l e , m o l e k l l e r k a n t l a r l a , m o d e r n in s a n n k k e n i b u l u n a m a z m ? Sanat ne zaman dodu? A v c a t a l a r m z n e z a m a n y e r l e i k y a a m a g e t i? lk kyler ne zaman kuruldu?..

y e r y z n n m ily a r la r c a y ld a g e ir d i i t m d e i im le r i, z e r in d e y a a y a n c a n lla rn e v r im iy le k o p m a z b a e r e v e s i n d e e l e a l y o r . H e m z o o l o j i h e m j e o l o j i lis a n s e i t i m i y a p m o l a n y a z a r n , D n y a ' n n m i l y a r l a r c a y l b o y u n c a a d e ta b i im d e n b i im e g irm e s in e y o l a an d i n a m i k y a p s n a n l a t r k e n u r a d k i m i s o r u l a r y le :

Dnya gezegeni nasl olutu? lk k a r a l a r n a s l d o d u ? Yerkabuu nasl geliti? lk o k y a n u s l a r n a s l o l u t u ? Yaam nasl balad ve geliti? A t m o s f e r n a s l o l u t u ? Yer'in dinamik halde olmasn salayan i ve d sreleri nelerdir? K t a l a r h a r e k e t e d e r m i ? Volkanizma nasl alr, nelere yol aar? F o s il n e d i r , f o s i l l e m e n a s l g e r e k l e i r ? Jeolojik zaman kavram nedir? j e o l o j i k o l a y l a r n a s l t a r l h l e n d l r l r i z ? Paleocorafya haritalar nasl yaplr? Y e r n t a r i h i b o y u n c a g r d i k l i m l e r i n a s l b ilir iz ? Akdeniz'in kurumasna neden olan tuz krizi nedir, ne zaman yaanmtr; hangi corafyalar etkilemitir?

byk batlama kuram Metin Hotinli

brahim Semiz, 50 Soruda Grelilik Kuramlar a d l k ita p ta , fiz ik te d e v r im s a y la n v e g n m z fiz i in in t e m e li o la n E in s te in 'n z e l v e g e n e l g r e lilik k u r a m la rn , b u k u r a m l a r n a l t y a p s n o l u t u r a n v e il in t i li o l d u u t m k o n u la rla b irlik te , o la b ile c e k e n y a ln b i im d e v e k e y ifli r n e k l e r l e a n l a t y o r . B o a z i i n i v e r s i t e s i F iz ik B l m r e tim y e s i o la n y a z a rn , k o n u y u e n b a s it e r e v e d e n b a la y a r a k g e n i le tir k e n g e ti i k im i s o ru la r y le : Nevvton'un hareket yasalar nedir; veba salgn sayesinde bulunduklar doru mudur? z e l g r e l i l i i n n e s i z e l ? Zaman genlemesi nedir; hzl giderek gen kalabilir miyim? U z a y - z a m a n n e d i r 7 Iktan hzl giden nesneler olabilir mi? N a s l, " g e n e l e k i m k u v v e t i " a s l n d a y o k m u ? Evrenin genlemesi ne demek? N e r e y e d o r u g e n l e i y o r 7 Her ey mi genleiyor? B e n d e g e n l e i y o r m u y u m ? Kara delik nedir? K a r a d e l i k b a k a e v re n le re y a d a e v re n in u z a k k e le rin e g e it o l a b i l i r m i 7 Ne olacak bu evrenin hali? Bu b ilg ile r n e i im e y a ra y a c a k ?

50 Soruda Byk Patlama Kuram k i t a b n d a , Prof. Dr. Metin Hotinli, e v r e n i n n a s l o l u t u u n u v e g e l e c e i n i a k la y a n b y k p a tla m a k u ra m n , d in a m ik v e e v r im h a lin d e b ir e v r e n g e r e in e u la m a n n ta rih i o la r a k e le a ly o r. Y a z a rn , in s a n l n e v r e n in d o u m u n a d a ir ilk d n c e l e r i n i i e r e n m i t o s l a r d a n b a l a y a r a k , b y k p a t la m a k u r a m n a u la rk e n g e ti i k im i s o r u la r y le :

lk kozmolojik dnceler ne zaman ortaya kt? A r i s t o t e l e s k o z m o l o j i m o d e l i n i n z e l l i k l e r i n e l e r d i ? zel ve genel grelilik kuramlar ne getirdi? G e n i l e y e n e v r e n d e n b y k p a t l a m a y a n a s l g e i l d i ? Byk pat lama kuramnda evrenin ya problemi nasl zl d? R a d y o a s t r o n o m i g z l e m v e r i l e r i d u r a a n e v r e n k u r a m y l a b a d a y o r m u ? Big bang kuramnda ilk dakikann nemi nedir? F o s il r a d y a s y o n n e d i r ? Big Bang'dan nce ne vard? E v r e n i n g e n i l e m e s i s r e c e k m i , d u r a c a k m ? Karanlk madde nedir? Karanlk enerji nedir? B y k P a t l a m a k u r a m k a lc m d r , d e i e b i l i r m i ? Big Bang kuramnn rakipleri var mdr?